Transcript: Human NR_110021.2

Homo sapiens dyskerin pseudouridine synthase 1 (DKC1), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
DKC1 (1736)
Length:
2946
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_110021.2
NBCI Gene record:
DKC1 (1736)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_110021.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344498 GGCACCTACATTCGGACATTA pLKO_005 1246 3UTR 100% 13.200 18.480 N DKC1 n/a
2 TRCN0000039740 CGCTGAAGAATTTCTTATCAA pLKO.1 675 3UTR 100% 5.625 7.875 N DKC1 n/a
3 TRCN0000332892 CGCTGAAGAATTTCTTATCAA pLKO_005 675 3UTR 100% 5.625 7.875 N DKC1 n/a
4 TRCN0000039742 CGGCTGCACAATGCTATTGAA pLKO.1 1051 3UTR 100% 5.625 7.875 N DKC1 n/a
5 TRCN0000332893 CGGCTGCACAATGCTATTGAA pLKO_005 1051 3UTR 100% 5.625 7.875 N DKC1 n/a
6 TRCN0000010325 TATGTTGACTACAGTGAGTCT pLKO.1 1825 3UTR 100% 2.640 3.696 N DKC1 n/a
7 TRCN0000352996 TATGTTGACTACAGTGAGTCT pLKO_005 1825 3UTR 100% 2.640 3.696 N DKC1 n/a
8 TRCN0000039739 GCACCTACATTCGGACATTAT pLKO.1 1247 3UTR 100% 13.200 9.240 N DKC1 n/a
9 TRCN0000039741 CGGAAGTCATTGCCAGAAGAA pLKO.1 157 3UTR 100% 4.950 3.465 N DKC1 n/a
10 TRCN0000039738 GCTCAGTGAAATGCTGTAGAA pLKO.1 2511 3UTR 100% 4.950 3.465 N DKC1 n/a
11 TRCN0000332894 GCTCAGTGAAATGCTGTAGAA pLKO_005 2511 3UTR 100% 4.950 3.465 N DKC1 n/a
12 TRCN0000010324 CACTATACACCTCTTGCATGT pLKO.1 781 3UTR 100% 4.050 2.835 N DKC1 n/a
13 TRCN0000010326 GATGTTACCTGGTGTGGTCAT pLKO.1 2271 3UTR 100% 4.050 2.430 N DKC1 n/a
14 TRCN0000160007 CAAGAAGAAGAAGAAGAAGTA pLKO.1 2070 3UTR 100% 4.950 2.475 Y FAM98C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_110021.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00446 pDONR223 100% 52.3% None (many diffs) n/a
2 ccsbBroad304_00446 pLX_304 0% 52.3% V5 (many diffs) n/a
3 TRCN0000474791 CTCTCTGCTTGCCACGACCCGTTG pLX_317 23.3% 52.3% V5 (many diffs) n/a
4 ccsbBroadEn_15398 pDONR223 0% 52.2% None (many diffs) n/a
5 ccsbBroad304_15398 pLX_304 0% 52.2% V5 (many diffs) n/a
6 TRCN0000473317 TAAGATGAATGGCACCACTCGTTC pLX_317 31.5% 52.2% V5 (many diffs) n/a
Download CSV