Transcript: Human NR_111939.1

Homo sapiens dual specificity phosphatase 10 (DUSP10), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-01-02
Taxon:
Homo sapiens (human)
Gene:
DUSP10 (11221)
Length:
1688
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_111939.1
NBCI Gene record:
DUSP10 (11221)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_111939.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220147 CAAAGGCAAACGACCAATTAT pLKO.1 561 3UTR 100% 15.000 21.000 N DUSP10 n/a
2 TRCN0000314618 TCAAAGGCAAACGACCAATTA pLKO_005 560 3UTR 100% 13.200 18.480 N DUSP10 n/a
3 TRCN0000314698 AGAACCTGCGGCAGTACTTTG pLKO_005 389 3UTR 100% 10.800 8.640 N DUSP10 n/a
4 TRCN0000340370 AGAACCTGCGGCAGTACTTTG pLKO_005 389 3UTR 100% 10.800 8.640 N Dusp10 n/a
5 TRCN0000380183 GACCATGACTGATGCTTATAA pLKO_005 534 3UTR 100% 15.000 10.500 N DUSP10 n/a
6 TRCN0000220148 GTGTTTCTGTTGATTGTGTAA pLKO.1 1633 3UTR 100% 4.950 3.465 N DUSP10 n/a
7 TRCN0000220150 CCACTATGAGAAAGGCCTGTT pLKO.1 330 3UTR 100% 4.050 2.835 N DUSP10 n/a
8 TRCN0000314700 CAAGTGTAAGAAGACTATAAC pLKO_005 846 3UTR 100% 13.200 7.920 N DUSP10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_111939.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07774 pDONR223 100% 27.3% None (many diffs) n/a
2 ccsbBroad304_07774 pLX_304 0% 27.3% V5 (many diffs) n/a
3 TRCN0000469524 GCCGTAACAGCGCTCCTATAAATT pLX_317 26.3% 27.3% V5 (many diffs) n/a
4 ccsbBroadEn_02648 pDONR223 100% 27.3% None (many diffs) n/a
5 ccsbBroad304_02648 pLX_304 0% 27.3% V5 (many diffs) n/a
6 TRCN0000479939 ACACAGGATGCCGTGCATAGTAGT pLX_317 26.3% 27.3% V5 (many diffs) n/a
7 TRCN0000488962 GTTCGGAGAGGCTCTATGGTTGGG pLX_317 21.2% 27.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV