Transcript: Human NR_126037.1

Homo sapiens SAP30 binding protein (SAP30BP), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2018-05-10
Taxon:
Homo sapiens (human)
Gene:
SAP30BP (29115)
Length:
2645
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_126037.1
NBCI Gene record:
SAP30BP (29115)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_126037.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146889 CCAGAAGCTTTATGAACGAAA pLKO.1 662 3UTR 100% 4.950 6.930 N SAP30BP n/a
2 TRCN0000280874 CCAGAAGCTTTATGAACGAAA pLKO_005 662 3UTR 100% 4.950 6.930 N SAP30BP n/a
3 TRCN0000180723 GACAGTCGGAAGATGACGATT pLKO.1 466 3UTR 100% 4.950 6.930 N SAP30BP n/a
4 TRCN0000280944 GACAGTCGGAAGATGACGATT pLKO_005 466 3UTR 100% 4.950 6.930 N SAP30BP n/a
5 TRCN0000180341 GAAATCAAGATCCCGCCAGAA pLKO.1 603 3UTR 100% 4.050 5.670 N SAP30BP n/a
6 TRCN0000280876 GAAATCAAGATCCCGCCAGAA pLKO_005 603 3UTR 100% 4.050 5.670 N SAP30BP n/a
7 TRCN0000147243 GAAGAAGATGAGAACAGTAGA pLKO.1 447 3UTR 100% 4.950 3.465 N SAP30BP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_126037.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03082 pDONR223 100% 29.4% None 1_257del;742_743ins113;1069_2645del n/a
2 ccsbBroad304_03082 pLX_304 0% 29.4% V5 1_257del;742_743ins113;1069_2645del n/a
3 TRCN0000467101 GTCAGCAAGTATGTGTCTGACAGT pLX_317 32% 29.4% V5 1_257del;742_743ins113;1069_2645del n/a
Download CSV