Transcript: Human NR_126447.1

Homo sapiens WARS2 intronic transcript 1 (WARS2-IT1), long non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
WARS2-IT1 (104472716)
Length:
562
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_126447.1
NBCI Gene record:
WARS2-IT1 (104472716)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_126447.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149979 CCTAGAGATTTGTGGAACTTT pLKO.1 480 3UTR 100% 5.625 2.813 Y UNC80 n/a
2 TRCN0000136213 GATGAGGAACTTGTTGGGAAT pLKO.1 401 3UTR 100% 4.050 2.430 N FLJ44955 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_126447.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10130 pDONR223 100% 22.3% None (many diffs) n/a
2 ccsbBroad304_10130 pLX_304 0% 22.3% V5 (many diffs) n/a
3 TRCN0000478580 CAAGCGTCTCATAAAATGGGCATG pLX_317 64.2% 22.3% V5 (many diffs) n/a
4 ccsbBroadEn_12850 pDONR223 100% 19.7% None (many diffs) n/a
5 ccsbBroad304_12850 pLX_304 0% 19.7% V5 (many diffs) n/a
6 TRCN0000475148 TGCTGTCGGCAGCCCTCCTCTTAC pLX_317 100% 19.7% V5 (many diffs) n/a
Download CSV