Transcript: Human NR_126496.1

Homo sapiens long intergenic non-protein coding RNA 1588 (LINC01588), transcript variant 1, long non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
LINC01588 (283551)
Length:
4835
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_126496.1
NBCI Gene record:
LINC01588 (283551)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_126496.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264165 ACGACACAGACATTTCGTCTT pLKO_005 864 3UTR 100% 4.050 5.670 N LINC01588 n/a
2 TRCN0000264164 GAAATGTCTACCGAGGAATTA pLKO_005 4040 3UTR 100% 13.200 10.560 N LINC01588 n/a
3 TRCN0000282937 TGCAGAGTGTATGACACATAA pLKO_005 4008 3UTR 100% 13.200 9.240 N LINC01588 n/a
4 TRCN0000264166 TCACGAACCGAGAGGTCTTTC pLKO_005 825 3UTR 100% 10.800 7.560 N LINC01588 n/a
5 TRCN0000264167 AGCCTGACAGAACCCAAGATG pLKO_005 800 3UTR 100% 4.950 3.465 N LINC01588 n/a
6 TRCN0000168773 GAGGTCTTTCAAGATCACACA pLKO.1 836 3UTR 100% 2.640 1.848 N LINC01588 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_126496.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13501 pDONR223 100% 8.1% None (many diffs) n/a
2 ccsbBroad304_13501 pLX_304 0% 8.1% V5 (many diffs) n/a
3 TRCN0000473817 TACCGAGCCCACTGGCCAGGTGCC pLX_317 80.4% 8.1% V5 (many diffs) n/a
Download CSV