Transcript: Human NR_130760.2

Homo sapiens nipsnap homolog 3B (NIPSNAP3B), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
NIPSNAP3B (55335)
Length:
1446
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_130760.2
NBCI Gene record:
NIPSNAP3B (55335)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_130760.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168655 GAAAGCCTTAGCCAACTGTAA pLKO.1 412 3UTR 100% 4.950 6.930 N NIPSNAP3B n/a
2 TRCN0000167791 GACGGAAATTACTTACCTGAT pLKO.1 487 3UTR 100% 4.050 5.670 N NIPSNAP3B n/a
3 TRCN0000172969 GCCAACTGTAAGGAATGGCAA pLKO.1 422 3UTR 100% 2.640 3.696 N NIPSNAP3B n/a
4 TRCN0000168499 GCTTCTGATTCCTGCATCATT pLKO.1 670 3UTR 100% 5.625 3.938 N NIPSNAP3B n/a
5 TRCN0000168359 GCTCTAAGATGTGTCTGCTAA pLKO.1 740 3UTR 100% 4.950 3.465 N NIPSNAP3B n/a
6 TRCN0000166932 GAACGTTCTATGAATTTCGTA pLKO.1 213 3UTR 100% 3.000 2.100 N NIPSNAP3B n/a
7 TRCN0000144213 CAGCAGAATATGCTTCTGATT pLKO.1 659 3UTR 100% 0.495 0.248 Y NIPSNAP3A n/a
8 TRCN0000144608 GAAAGTGTCAACTACCTAGTA pLKO.1 635 3UTR 100% 4.950 2.475 Y NIPSNAP3A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_130760.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03584 pDONR223 100% 37% None 1_112del;540_541ins150;704_1446del n/a
2 ccsbBroad304_03584 pLX_304 0% 37% V5 1_112del;540_541ins150;704_1446del n/a
3 TRCN0000481287 CCCAGGGAGACTGACGTTACTGCA pLX_317 58.6% 37% V5 1_112del;540_541ins150;704_1446del n/a
4 ccsbBroadEn_02888 pDONR223 100% 33.8% None (many diffs) n/a
5 ccsbBroad304_02888 pLX_304 0% 33.8% V5 (many diffs) n/a
6 TRCN0000474361 CAGACAACCGACCCGATGCCGGAT pLX_317 70.3% 33.8% V5 (many diffs) n/a
Download CSV