Transcript: Human NR_130914.1

Homo sapiens long intergenic non-protein coding RNA 1949 (LINC01949), long non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
LINC01949 (55338)
Length:
2898
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_130914.1
NBCI Gene record:
LINC01949 (55338)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_130914.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000131153 GCACAGCTTCAGGACACTTAA pLKO.1 1171 3UTR 100% 13.200 9.240 N LINC01949 n/a
2 TRCN0000130890 GCCATTACTGAGGCTTGATTA pLKO.1 930 3UTR 100% 13.200 7.920 N LINC01949 n/a
3 TRCN0000131217 GAATAGGAACAGCTCTGCTCT pLKO.1 322 3UTR 100% 2.640 1.584 N LINC01949 n/a
4 TRCN0000136988 CCTCCAAGAAATATGGGACTA pLKO.1 2057 3UTR 100% 4.050 2.025 Y LOC440258 n/a
5 TRCN0000127836 GCATGTTCTAACCCAATGCAA pLKO.1 1795 3UTR 100% 3.000 1.500 Y LINC01949 n/a
6 TRCN0000121782 CCAGCCAAACTAAGCTTCATA pLKO.1 2468 3UTR 100% 5.625 2.813 Y FLJ44796 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_130914.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12206 pDONR223 100% 15% None (many diffs) n/a
2 ccsbBroad304_12206 pLX_304 0% 15% V5 (many diffs) n/a
3 TRCN0000477579 AGAAACCCATAAAATACACTCAGT pLX_317 73.1% 15% V5 (many diffs) n/a
4 ccsbBroadEn_15949 pDONR223 0% 9.6% None (many diffs) n/a
5 ccsbBroad304_15949 pLX_304 0% 9.6% V5 (many diffs) n/a
6 TRCN0000471984 GACGATGCTGCTGGTGATGGACGC pLX_317 100% 9.6% V5 (many diffs) n/a
Download CSV