Transcript: Human NR_130918.1

Homo sapiens CCDC26 long non-coding RNA (CCDC26), transcript variant 2, long non-coding RNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
CCDC26 (137196)
Length:
1495
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_130918.1
NBCI Gene record:
CCDC26 (137196)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_130918.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161541 GTATCAAAGGTTAGTGGTGAA pLKO.1 377 3UTR 100% 4.050 5.670 N CCDC26 n/a
2 TRCN0000160799 CCCTAATATCTGTTTGACCTT pLKO.1 678 3UTR 100% 2.640 3.696 N CCDC26 n/a
3 TRCN0000160218 CCAGTACTTCACAATAAGTAT pLKO.1 1204 3UTR 100% 0.563 0.450 N CCDC26 n/a
4 TRCN0000160313 CACTGGAAATGATAGACAATA pLKO.1 475 3UTR 100% 13.200 9.240 N CCDC26 n/a
5 TRCN0000160314 CTGGAAATGATAGACAATATG pLKO.1 477 3UTR 100% 13.200 9.240 N CCDC26 n/a
6 TRCN0000164780 CGAGCAGAGACAGAGAAGAAA pLKO.1 268 3UTR 100% 5.625 3.938 N CCDC26 n/a
7 TRCN0000163587 GCAGGTTCACTGGAAATGATA pLKO.1 468 3UTR 100% 5.625 3.938 N CCDC26 n/a
8 TRCN0000165017 GCAGTGAGGAATCTGTGTGTT pLKO.1 593 3UTR 100% 4.950 3.465 N CCDC26 n/a
9 TRCN0000164313 CCACAGAGAGAATATCCAGTA pLKO.1 1189 3UTR 100% 4.050 2.835 N CCDC26 n/a
10 TRCN0000161620 GCTTATTGAATTGGCTAGGAT pLKO.1 1111 3UTR 100% 3.000 2.100 N CCDC26 n/a
11 TRCN0000165920 GAAAGATCGAGCAGAGACAGA pLKO.1 261 3UTR 100% 2.640 1.848 N CCDC26 n/a
12 TRCN0000164942 GAGGAGAGAAGAGAGCTGAAA pLKO.1 507 3UTR 100% 4.950 2.970 N CCDC26 n/a
13 TRCN0000162590 CCTTAGTTTCTTTGTCTGGAA pLKO.1 724 3UTR 100% 2.640 1.584 N CCDC26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_130918.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16094 pDONR223 0% 21.8% None 1_200del;528_1495del n/a
2 ccsbBroad304_16094 pLX_304 0% 21.8% V5 1_200del;528_1495del n/a
3 TRCN0000468297 TTAAATTAAAGATGGAAGACGGAA pLX_317 100% 21.8% V5 1_200del;528_1495del n/a
4 ccsbBroadEn_13190 pDONR223 100% 21.8% None 1_200del;410G>A;528_1495del n/a
5 ccsbBroad304_13190 pLX_304 0% 21.8% V5 1_200del;410G>A;528_1495del n/a
6 TRCN0000475413 GCATTCACTCATAAAGGCCACCCT pLX_317 100% 21.8% V5 1_200del;410G>A;528_1495del n/a
Download CSV