Transcript: Human NR_131032.2

Homo sapiens ALG14 UDP-N-acetylglucosaminyltransferase subunit (ALG14), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ALG14 (199857)
Length:
9223
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_131032.2
NBCI Gene record:
ALG14 (199857)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_131032.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146599 CAAATGGCAACTGACTTCTTT pLKO.1 553 3UTR 100% 5.625 7.875 N ALG14 n/a
2 TRCN0000147745 CTGACAGTCCTGAGAATTATT pLKO.1 648 3UTR 100% 15.000 10.500 N ALG14 n/a
3 TRCN0000435682 ACCCTACATGTTTCTTGTAAA pLKO_005 622 3UTR 100% 13.200 9.240 N ALG14 n/a
4 TRCN0000429346 GATCATTGTCTACGTTGAAAG pLKO_005 402 3UTR 100% 10.800 7.560 N ALG14 n/a
5 TRCN0000150263 GAGGCTTCTCTTATGAAACAA pLKO.1 714 3UTR 100% 5.625 3.938 N ALG14 n/a
6 TRCN0000179241 GAAGAAACTGAGGCTTCTCTT pLKO.1 705 3UTR 100% 4.950 2.970 N ALG14 n/a
7 TRCN0000204533 CCTCCCAAAGTGCTGGAATTA pLKO.1 4581 3UTR 100% 13.200 6.600 Y LRRC74B n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5287 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 1290 3UTR 100% 13.200 6.600 Y IQCC n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5288 3UTR 100% 13.200 6.600 Y LIAS n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 7867 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000161892 GCCTGTAATTCCAGCTACTTA pLKO.1 5421 3UTR 100% 5.625 2.813 Y GPN2 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 7867 3UTR 100% 5.625 2.813 Y EID2B n/a
14 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1220 3UTR 100% 4.950 2.475 Y ERN2 n/a
15 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1220 3UTR 100% 4.950 2.475 Y P3H4 n/a
16 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1220 3UTR 100% 4.950 2.475 Y P3H4 n/a
17 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 1389 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_131032.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09800 pDONR223 100% 5.2% None (many diffs) n/a
2 ccsbBroad304_09800 pLX_304 0% 5.2% V5 (many diffs) n/a
3 TRCN0000474727 CGTGGCCTGTGACTCCAGGGAATA pLX_317 70.3% 5.2% V5 (many diffs) n/a
4 ccsbBroadEn_10792 pDONR223 100% 2.3% None (many diffs) n/a
5 ccsbBroad304_10792 pLX_304 0% 2.3% V5 (many diffs) n/a
6 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 2.3% V5 (many diffs) n/a
Download CSV