Transcript: Human NR_131176.2

Homo sapiens thioredoxin like 4A (TXNL4A), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
TXNL4A (10907)
Length:
3542
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_131176.2
NBCI Gene record:
TXNL4A (10907)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_131176.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064063 CGATCCATGTACTGTCATGTT pLKO.1 399 3UTR 100% 4.950 6.930 N TXNL4A n/a
2 TRCN0000311672 CGATCCATGTACTGTCATGTT pLKO_005 399 3UTR 100% 4.950 6.930 N TXNL4A n/a
3 TRCN0000064067 CAACAAGATTAACTGGGCCAT pLKO.1 538 3UTR 100% 2.160 3.024 N TXNL4A n/a
4 TRCN0000311674 CAACAAGATTAACTGGGCCAT pLKO_005 538 3UTR 100% 2.160 3.024 N TXNL4A n/a
5 TRCN0000064065 ACTGGCAACAACAACAAGATT pLKO.1 527 3UTR 100% 5.625 3.938 N TXNL4A n/a
6 TRCN0000311673 ACTGGCAACAACAACAAGATT pLKO_005 527 3UTR 100% 5.625 3.938 N TXNL4A n/a
7 TRCN0000064064 CAAGGACTACTCCACCAAGTA pLKO.1 640 3UTR 100% 4.950 3.465 N TXNL4A n/a
8 TRCN0000311675 CAAGGACTACTCCACCAAGTA pLKO_005 640 3UTR 100% 4.950 3.465 N TXNL4A n/a
9 TRCN0000064066 GCAGTTATTTATCTTGTGGAT pLKO.1 337 3UTR 100% 2.640 1.848 N TXNL4A n/a
10 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1612 3UTR 100% 4.950 2.475 Y CFLAR n/a
11 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1612 3UTR 100% 4.950 2.475 Y C19orf31 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2746 3UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 1776 3UTR 100% 10.800 5.400 Y SMIM11A n/a
14 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1610 3UTR 100% 4.950 2.475 Y ERN2 n/a
15 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1610 3UTR 100% 4.950 2.475 Y P3H4 n/a
16 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1610 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_131176.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02555 pDONR223 100% 12% None 1_171del;428_497del;668_3542del n/a
2 ccsbBroad304_02555 pLX_304 0% 12% V5 1_171del;428_497del;668_3542del n/a
3 TRCN0000467428 ACCCGCCTCTGCCGCGGTAATACA pLX_317 73.9% 12% V5 1_171del;428_497del;668_3542del n/a
Download CSV