Transcript: Human NR_134849.2

Homo sapiens collagen type XXI alpha 1 chain (COL21A1), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
COL21A1 (81578)
Length:
4165
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_134849.2
NBCI Gene record:
COL21A1 (81578)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_134849.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371869 TCGTACTGCTCCGACAGATTT pLKO_005 325 3UTR 100% 13.200 18.480 N COL21A1 n/a
2 TRCN0000116899 CCTCAAGTTAAGACGTTGTTT pLKO.1 1247 3UTR 100% 5.625 7.875 N COL21A1 n/a
3 TRCN0000116898 CCCTCAAGTTAAGACGTTGTT pLKO.1 1246 3UTR 100% 4.950 6.930 N COL21A1 n/a
4 TRCN0000371868 ACATGGAAAGGATGGATTAAT pLKO_005 1943 3UTR 100% 15.000 10.500 N COL21A1 n/a
5 TRCN0000371870 TTACAACAACCAGCGTAATTA pLKO_005 1197 3UTR 100% 15.000 10.500 N COL21A1 n/a
6 TRCN0000116897 CCCTTGGATTAGCAGCATTAA pLKO.1 3289 3UTR 100% 13.200 9.240 N COL21A1 n/a
7 TRCN0000116901 CCTGGTTTAATGGGAAGCAAT pLKO.1 2133 3UTR 100% 4.950 3.465 N COL21A1 n/a
8 TRCN0000116900 GCCTTCGTCTACTTATGTGTT pLKO.1 787 3UTR 100% 4.950 3.465 N COL21A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_134849.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09074 pDONR223 100% 68.5% None (many diffs) n/a
2 ccsbBroad304_09074 pLX_304 0% 68.5% V5 (many diffs) n/a
3 ccsbBroadEn_12722 pDONR223 100% 34.5% None (many diffs) n/a
4 ccsbBroad304_12722 pLX_304 0% 34.5% V5 (many diffs) n/a
5 TRCN0000477491 TAGCCATCCGACGGCTTTCAGCGT pLX_317 5.2% 34.5% V5 (many diffs) n/a
Download CSV