Transcript: Human NR_135496.2

Homo sapiens leukocyte immunoglobulin like receptor B3 (LILRB3), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
LILRB3 (11025)
Length:
2825
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135496.2
NBCI Gene record:
LILRB3 (11025)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135496.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056783 TGACCAGAGAAAGACTGATTT pLKO.1 1539 3UTR 100% 13.200 6.600 Y LILRB3 n/a
2 TRCN0000431917 CCTTGAACACAAGAAGTTAAG pLKO_005 2308 3UTR 100% 10.800 5.400 Y LILRB3 n/a
3 TRCN0000425280 ATTATACATCGAACTTATGAC pLKO_005 2448 3UTR 100% 4.950 2.475 Y LILRB3 n/a
4 TRCN0000060502 GACACTTTCCTTCTGACCAAA pLKO.1 1168 3UTR 100% 4.950 2.475 Y LILRA6 n/a
5 TRCN0000056787 GCTCATAAGTACCAGGCTGAA pLKO.1 1234 3UTR 100% 4.050 2.025 Y LILRB3 n/a
6 TRCN0000056785 GTCACAGCAAACACAGGACAT pLKO.1 1517 3UTR 100% 4.050 2.025 Y LILRB3 n/a
7 TRCN0000060501 GACAGAAATAACCCACTGGAA pLKO.1 239 3UTR 100% 2.640 1.320 Y LILRA6 n/a
8 TRCN0000417376 CCACACCTGGTCTGGGAAGAT pLKO_005 1415 3UTR 100% 1.650 0.825 Y LILRB3 n/a
9 TRCN0000056786 CCTCCGATGTGGCTCACAGAA pLKO.1 454 3UTR 100% 1.650 0.825 Y LILRB3 n/a
10 TRCN0000056847 CGACAGATTTGTTCTGTATAA pLKO.1 867 3UTR 100% 1.320 0.660 Y LILRA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135496.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11582 pDONR223 100% 65.1% None (many diffs) n/a
2 ccsbBroad304_11582 pLX_304 0% 65.1% V5 (many diffs) n/a
3 TRCN0000476797 GACTTACTCCCCGGATCTCGTAGG pLX_317 13.1% 65.1% V5 (many diffs) n/a
4 ccsbBroadEn_07723 pDONR223 100% 39.3% None (many diffs) n/a
5 ccsbBroad304_07723 pLX_304 0% 39.3% V5 (many diffs) n/a
6 TRCN0000478308 ATCGACTTCGATGCCTGGACTCCC pLX_317 25% 39.3% V5 (many diffs) n/a
Download CSV