Transcript: Human NR_135591.1

Homo sapiens histone deacetylase 6 (HDAC6), transcript variant 9, non-coding RNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
HDAC6 (10013)
Length:
3855
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135591.1
NBCI Gene record:
HDAC6 (10013)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135591.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314908 CTCACTGATCAGGCCATATTT pLKO_005 3129 3UTR 100% 15.000 21.000 N HDAC6 n/a
2 TRCN0000314910 GTCACTTCGAAGCGAAATATT pLKO_005 115 3UTR 100% 15.000 21.000 N HDAC6 n/a
3 TRCN0000314909 TATCCTAGAGGGTGGCTATAA pLKO_005 2165 3UTR 100% 13.200 18.480 N HDAC6 n/a
4 TRCN0000380796 CCCAATCTAGCGGAGGTAAAG pLKO_005 163 3UTR 100% 10.800 15.120 N HDAC6 n/a
5 TRCN0000381582 GAGGGTCCTTATCGTAGATTG pLKO_005 765 3UTR 100% 10.800 15.120 N HDAC6 n/a
6 TRCN0000199967 CGGAGGGTCCTTATCGTAGAT pLKO.1 763 3UTR 100% 4.950 6.930 N HDAC6 n/a
7 TRCN0000004842 CGGTAATGGAACTCAGCACAT pLKO.1 1986 3UTR 100% 4.050 5.670 N HDAC6 n/a
8 TRCN0000350401 CGGTAATGGAACTCAGCACAT pLKO_005 1986 3UTR 100% 4.050 5.670 N HDAC6 n/a
9 TRCN0000194771 CAACTTTGACTCCATCTATAT pLKO.1 1722 3UTR 100% 13.200 9.240 N HDAC6 n/a
10 TRCN0000004843 CCTCACTGATCAGGCCATATT pLKO.1 3128 3UTR 100% 13.200 9.240 N HDAC6 n/a
11 TRCN0000004839 CATCCCATCCTGAATATCCTT pLKO.1 3584 3UTR 100% 3.000 2.100 N HDAC6 n/a
12 TRCN0000314976 CATCCCATCCTGAATATCCTT pLKO_005 3584 3UTR 100% 3.000 2.100 N HDAC6 n/a
13 TRCN0000004841 GCACAGTCTTATGGATGGCTA pLKO.1 684 3UTR 100% 2.640 1.848 N HDAC6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135591.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489770 GAAGAAAACACCGAGAGAACTGCA pLX_317 9.4% 85.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_11446 pDONR223 100% 74% None 1_486del;2022_2023ins193;3483_3855del n/a
3 ccsbBroad304_11446 pLX_304 0% 74% V5 1_486del;2022_2023ins193;3483_3855del n/a
4 TRCN0000471558 GAAAAATATGGGGCTTAAGGCGCA pLX_317 13.3% 74% V5 1_486del;2022_2023ins193;3483_3855del n/a
5 ccsbBroadEn_11445 pDONR223 100% 11.3% None 1_30del;468_3855delinsG n/a
6 ccsbBroad304_11445 pLX_304 0% 11.3% V5 1_30del;468_3855delinsG n/a
7 TRCN0000473847 ACACTGCCCGTATTCTGTATTAAG pLX_317 77.9% 11.3% V5 1_30del;468_3855delinsG n/a
Download CSV