Transcript: Human NR_136182.2

Homo sapiens centromere protein O (CENPO), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
CENPO (79172)
Length:
3910
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_136182.2
NBCI Gene record:
CENPO (79172)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_136182.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072755 CCAATGTAGAACCCAACCAAA pLKO.1 283 3UTR 100% 4.950 6.930 N CENPO n/a
2 TRCN0000291632 CCAATGTAGAACCCAACCAAA pLKO_005 283 3UTR 100% 4.950 6.930 N CENPO n/a
3 TRCN0000072754 GCCAGCGTGAAAGCATGTATT pLKO.1 261 3UTR 100% 13.200 10.560 N CENPO n/a
4 TRCN0000291697 GCCAGCGTGAAAGCATGTATT pLKO_005 261 3UTR 100% 13.200 10.560 N CENPO n/a
5 TRCN0000072753 GCTCACACATCCACGAACAAA pLKO.1 1315 3UTR 100% 5.625 4.500 N CENPO n/a
6 TRCN0000307743 GCTCACACATCCACGAACAAA pLKO_005 1315 3UTR 100% 5.625 4.500 N CENPO n/a
7 TRCN0000072757 GTGAAAGCATGTATTGCCAAT pLKO.1 267 3UTR 100% 4.050 2.835 N CENPO n/a
8 TRCN0000072756 GCAGAGAAACCCACTGTGTAA pLKO.1 576 3UTR 100% 4.950 2.970 N CENPO n/a
9 TRCN0000291633 GCAGAGAAACCCACTGTGTAA pLKO_005 576 3UTR 100% 4.950 2.970 N CENPO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_136182.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04066 pDONR223 100% 19.5% None (many diffs) n/a
2 ccsbBroad304_04066 pLX_304 0% 19.5% V5 (many diffs) n/a
3 TRCN0000470560 ATGATTTACGCTCCTGAGTCAACA pLX_317 47% 19.5% V5 (many diffs) n/a
Download CSV