Transcript: Human NR_137330.2

Homo sapiens xenotropic and polytropic retrovirus receptor 1 (XPR1), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
XPR1 (9213)
Length:
8117
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_137330.2
NBCI Gene record:
XPR1 (9213)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_137330.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014298 CCCTGTCGTAACTCCAGTAAA pLKO.1 3673 3UTR 100% 13.200 18.480 N XPR1 n/a
2 TRCN0000014300 CGTGACACTAAGGTATTGATA pLKO.1 1854 3UTR 100% 5.625 7.875 N XPR1 n/a
3 TRCN0000014301 GCCGCTGTATTTAAACTTGAA pLKO.1 940 3UTR 100% 4.950 6.930 N XPR1 n/a
4 TRCN0000014302 GCGATTTGTGTGGAACTTCTT pLKO.1 1622 3UTR 100% 4.950 6.930 N XPR1 n/a
5 TRCN0000358252 ACTACTACTGTGCCATAATAG pLKO_005 1486 3UTR 100% 13.200 9.240 N XPR1 n/a
6 TRCN0000358251 CCTTGTGCTTGCCGCTGTATT pLKO_005 930 3UTR 100% 13.200 9.240 N XPR1 n/a
7 TRCN0000014299 GCCATAATAGAGGATGTGATT pLKO.1 1497 3UTR 100% 4.950 3.465 N XPR1 n/a
8 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 4815 3UTR 100% 13.200 6.600 Y IQCC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_137330.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02109 pDONR223 100% 20.7% None 1_180del;1313_1314ins172;1902_8117del n/a
2 ccsbBroad304_02109 pLX_304 0% 20.7% V5 1_180del;1313_1314ins172;1902_8117del n/a
3 TRCN0000469141 GGAAATACCGTCAGAAGCAGGCCC pLX_317 24% 20.7% V5 1_180del;1313_1314ins172;1902_8117del n/a
4 TRCN0000487748 GCCGGCGACGTTAGTGAGACCTCG pLX_317 13.9% 20.2% V5 1_180del;1313_1314ins367;1902_8117delinsA n/a
Download CSV