Transcript: Human NR_138607.2

Homo sapiens MAPK regulated corepressor interacting protein 2 (MCRIP2), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
MCRIP2 (84331)
Length:
938
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_138607.2
NBCI Gene record:
MCRIP2 (84331)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_138607.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233237 CACCTGAAGTGCCAGCATTTG pLKO_005 752 3UTR 100% 10.800 7.560 N MCRIP2 n/a
2 TRCN0000233236 GCAGAACTTTGTGCCCATTGA pLKO_005 579 3UTR 100% 4.950 3.465 N MCRIP2 n/a
3 TRCN0000238816 CAGCAGTTCCTGGCGAGAATC pLKO_005 619 3UTR 100% 3.600 2.520 N MCRIP2 n/a
4 TRCN0000180958 GAACTTTGTGCCCATTGACCT pLKO.1 582 3UTR 100% 2.640 1.848 N MCRIP2 n/a
5 TRCN0000238815 ACGAGGAGAATGTCCGCTTTG pLKO_005 452 3UTR 100% 6.000 3.600 N MCRIP2 n/a
6 TRCN0000233235 GGCCAAGGCTTGTGTTCAATC pLKO_005 359 3UTR 100% 10.800 5.400 Y MCRIP2 n/a
7 TRCN0000179504 GCTTGTGTTCAATCGTGTGAA pLKO.1 366 3UTR 100% 4.950 2.475 Y MCRIP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_138607.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04381 pDONR223 100% 45.8% None (many diffs) n/a
2 ccsbBroad304_04381 pLX_304 0% 45.8% V5 (many diffs) n/a
3 TRCN0000468656 GTTCCTGAATCCCGGAATTACAAA pLX_317 87.6% 45.8% V5 (many diffs) n/a
4 ccsbBroadEn_16031 pDONR223 0% 29.6% None (many diffs) n/a
5 ccsbBroad304_16031 pLX_304 0% 29.6% V5 (many diffs) n/a
6 TRCN0000466834 TTCGGAGGTAGCAAGAGCAATCTT pLX_317 100% 29.5% V5 (many diffs) n/a
Download CSV