Transcript: Human NR_144414.2

Homo sapiens syntaxin 18 (STX18), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
STX18 (53407)
Length:
2099
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_144414.2
NBCI Gene record:
STX18 (53407)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_144414.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382254 GACATAAGAGAGGCCATTAAA pLKO_005 926 3UTR 100% 15.000 21.000 N STX18 n/a
2 TRCN0000379402 GCAAAGGCGAAGATGAGTTAT pLKO_005 746 3UTR 100% 13.200 18.480 N STX18 n/a
3 TRCN0000137053 CCTAATTGTCTCAGGGTTCAA pLKO.1 1374 3UTR 100% 4.950 6.930 N STX18 n/a
4 TRCN0000319349 CCTAATTGTCTCAGGGTTCAA pLKO_005 1374 3UTR 100% 4.950 6.930 N STX18 n/a
5 TRCN0000136717 CGCGAAGTGATTTCTCACATT pLKO.1 244 3UTR 100% 4.950 6.930 N STX18 n/a
6 TRCN0000319346 CGCGAAGTGATTTCTCACATT pLKO_005 244 3UTR 100% 4.950 6.930 N STX18 n/a
7 TRCN0000380615 ACAGAGAGCCATCCGAGTTAA pLKO_005 537 3UTR 100% 13.200 9.240 N STX18 n/a
8 TRCN0000133821 CTGGAACACAGGAAAGATTAT pLKO.1 286 3UTR 100% 13.200 9.240 N STX18 n/a
9 TRCN0000319347 CTGGAACACAGGAAAGATTAT pLKO_005 286 3UTR 100% 13.200 9.240 N STX18 n/a
10 TRCN0000381339 GACCAGGATGCCCAGATATTC pLKO_005 373 3UTR 100% 13.200 7.920 N STX18 n/a
11 TRCN0000167407 GTCAACGAATACACAGACTTA pLKO.1 1506 3UTR 100% 4.950 2.970 N STX18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_144414.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08349 pDONR223 100% 43.7% None (many diffs) n/a
2 ccsbBroad304_08349 pLX_304 0% 43.7% V5 (many diffs) n/a
3 TRCN0000471910 TACCTATGTTCTCCAGCTTGTACC pLX_317 36.2% 43.7% V5 (many diffs) n/a
Download CSV