Transcript: Human NR_144447.1

Homo sapiens ZNF8-ERVK3-1 readthrough (ZNF8-ERVK3-1), long non-coding RNA.

Source:
NCBI, updated 2019-03-15
Taxon:
Homo sapiens (human)
Gene:
ZNF8-ERVK3-1 (108903150)
Length:
4687
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_144447.1
NBCI Gene record:
ZNF8-ERVK3-1 (108903150)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_144447.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236569 GAAGCGACAGACCCTTCAAAT pLKO_005 2963 3UTR 100% 13.200 6.600 Y ZNF8 n/a
2 TRCN0000257092 GACTGTGGGAAGTCGTTTAAC pLKO_005 2359 3UTR 100% 13.200 6.600 Y ZNF8 n/a
3 TRCN0000236570 GATTACAGACTCAGAACATAA pLKO_005 2196 3UTR 100% 13.200 6.600 Y ZNF8 n/a
4 TRCN0000141753 GTAGTGTCCTGTGCGTCTATA pLKO.1 3763 3UTR 100% 13.200 6.600 Y LOC113386 n/a
5 TRCN0000143800 GCAACCACTAATCCACGTTAT pLKO.1 4406 3UTR 100% 10.800 5.400 Y LOC113386 n/a
6 TRCN0000236568 TCCCGACAGATGCTCCTTATC pLKO_005 1958 3UTR 100% 10.800 5.400 Y ZNF8 n/a
7 TRCN0000108079 GTGCAGGACAAACCCTACAAA pLKO.1 2332 3UTR 100% 5.625 2.813 Y ZNF8 n/a
8 TRCN0000140972 CCAGCGGAATCTGAATGCAAA pLKO.1 3594 3UTR 100% 4.950 2.475 Y LOC113386 n/a
9 TRCN0000108078 CCAGCTCTCACAAAGCATGAA pLKO.1 2887 3UTR 100% 4.950 2.475 Y ZNF8 n/a
10 TRCN0000108076 CCCAAATCCATTCCCAGAGAT pLKO.1 2139 3UTR 100% 4.950 2.475 Y ZNF8 n/a
11 TRCN0000143505 GCACAGCCTGAAATTACCTTT pLKO.1 3819 3UTR 100% 4.950 2.475 Y LOC113386 n/a
12 TRCN0000108077 TCAGAACATAACTCCAGCTTA pLKO.1 2206 3UTR 100% 4.950 2.475 Y ZNF8 n/a
13 TRCN0000122286 CCATGTTCTTGGCCATGCTAG pLKO.1 3740 3UTR 100% 4.050 2.025 Y LOC113386 n/a
14 TRCN0000141701 CCTCCCTATTCACTCTACCTA pLKO.1 4135 3UTR 100% 3.000 1.500 Y LOC113386 n/a
15 TRCN0000145609 CCTTCTTTCAAACAGATCCTT pLKO.1 4219 3UTR 100% 3.000 1.500 Y LOC113386 n/a
16 TRCN0000122370 CGGAGTCACAATGACATCCAA pLKO.1 3633 3UTR 100% 3.000 1.500 Y LOC113386 n/a
17 TRCN0000122725 CCATGCTAGCTGTAGTGTCCT pLKO.1 3752 3UTR 100% 2.640 1.320 Y LOC113386 n/a
18 TRCN0000141149 CCTTGAGGTTATCCACAGGAA pLKO.1 4036 3UTR 100% 2.640 1.320 Y LOC113386 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_144447.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07147 pDONR223 100% 36.3% None (many diffs) n/a
2 ccsbBroad304_07147 pLX_304 0% 36.3% V5 (many diffs) n/a
3 TRCN0000469315 GGACTCACAACCGATTTTTTACAC pLX_317 25% 36.3% V5 (many diffs) n/a
4 ccsbBroadEn_13022 pDONR223 100% 4.7% None 1_3588del;3811_4687del n/a
5 ccsbBroad304_13022 pLX_304 0% 4.7% V5 1_3588del;3811_4687del n/a
6 TRCN0000480345 TTAGGACTGACAGGTGTCCCCCAC pLX_317 100% 4.7% V5 1_3588del;3811_4687del n/a
Download CSV