Transcript: Human NR_144512.1

Homo sapiens selenoprotein F (SELENOF), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
SELENOF (9403)
Length:
1619
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_144512.1
NBCI Gene record:
SELENOF (9403)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_144512.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422778 AGCTGTATGCAGGAGCTATTC pLKO_005 328 3UTR 100% 10.800 15.120 N SELENOF n/a
2 TRCN0000436521 GGACTGCAAATCAAGTATGTC pLKO_005 429 3UTR 100% 4.950 6.930 N SELENOF n/a
3 TRCN0000128256 GATCAGATACATACTTGGCAA pLKO.1 1219 3UTR 100% 2.640 3.696 N SELENOF n/a
4 TRCN0000130149 CTTTGCAGCTCTTGTGATCTT pLKO.1 228 3UTR 100% 4.950 3.465 N SELENOF n/a
5 TRCN0000130466 GACAATGGGAACATTGCTGAA pLKO.1 483 3UTR 100% 0.405 0.284 N SELENOF n/a
6 TRCN0000128866 GAAAGGAATGACAGCAGACTA pLKO.1 953 3UTR 100% 4.950 2.970 N SELENOF n/a
7 TRCN0000128131 CATTCTCAAATGGAACACAGA pLKO.1 512 3UTR 100% 2.640 1.584 N SELENOF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_144512.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14017 pDONR223 100% 28.2% None (many diffs) n/a
2 ccsbBroad304_14017 pLX_304 0% 28.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000470393 ACAGGTTTTCAGCGTGGGCTAATC pLX_317 91.8% 28.2% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_11365 pDONR223 100% 11.6% None 1_333del;390_439del;573_1619del n/a
5 ccsbBroad304_11365 pLX_304 0% 11.6% V5 1_333del;390_439del;573_1619del n/a
6 TRCN0000473250 TCCTATCACACGCACTATCTAATG pLX_317 100% 11.6% V5 1_333del;390_439del;573_1619del n/a
Download CSV