Transcript: Human NR_144640.2

Homo sapiens pitrilysin metallopeptidase 1 (PITRM1), transcript variant 12, non-coding RNA.

Source:
NCBI, updated 2019-08-01
Taxon:
Homo sapiens (human)
Gene:
PITRM1 (10531)
Length:
3701
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_144640.2
NBCI Gene record:
PITRM1 (10531)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_144640.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310116 CCGGACATCACCGACACATTT pLKO_005 1013 3UTR 100% 13.200 18.480 N PITRM1 n/a
2 TRCN0000052241 CGGTGAATTACGTGGGTGAAT pLKO.1 2869 3UTR 100% 4.950 6.930 N PITRM1 n/a
3 TRCN0000052240 CCAGCGTTGAAAGTTTCCGAT pLKO.1 1682 3UTR 100% 2.640 3.696 N PITRM1 n/a
4 TRCN0000296025 TACACCTCCGAGCTGAATATG pLKO_005 3437 3UTR 100% 13.200 9.240 N PITRM1 n/a
5 TRCN0000052242 CCCAAGCAATGCTAGGTTCTT pLKO.1 787 3UTR 100% 4.950 3.465 N PITRM1 n/a
6 TRCN0000288803 CCCAAGCAATGCTAGGTTCTT pLKO_005 787 3UTR 100% 4.950 3.465 N PITRM1 n/a
7 TRCN0000052239 GCAGTATAAACTAGGAGACAA pLKO.1 124 3UTR 100% 4.950 3.465 N PITRM1 n/a
8 TRCN0000052238 GCACGTTTGATGACTGCCAAA pLKO.1 2943 3UTR 100% 4.050 2.835 N PITRM1 n/a
9 TRCN0000288804 GCACGTTTGATGACTGCCAAA pLKO_005 2943 3UTR 100% 4.050 2.835 N PITRM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_144640.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15717 pDONR223 0% 83.8% None (many diffs) n/a
2 ccsbBroad304_15717 pLX_304 0% 83.8% V5 (many diffs) n/a
3 TRCN0000471723 AACCCAGACTCCGGGTGATACACA pLX_317 11.7% 83.8% V5 (many diffs) n/a
4 TRCN0000478736 ACCTAGGCACAACGCTACTCATCA pLX_317 28.9% 43.2% V5 (many diffs) n/a
5 ccsbBroadEn_11517 pDONR223 100% 43.2% None (many diffs) n/a
6 ccsbBroad304_11517 pLX_304 0% 43.2% V5 (many diffs) n/a
Download CSV