Transcript: Human NR_145477.2

Homo sapiens RIO kinase 3 (RIOK3), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
RIOK3 (8780)
Length:
3596
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_145477.2
NBCI Gene record:
RIOK3 (8780)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_145477.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195503 CCTTAGTGAACGAGAACTCTT pLKO.1 1549 3UTR 100% 4.950 6.930 N RIOK3 n/a
2 TRCN0000197149 GCTGACCTCAGTGAGTATAAC pLKO.1 1366 3UTR 100% 13.200 10.560 N RIOK3 n/a
3 TRCN0000342727 GCTGACCTCAGTGAGTATAAC pLKO_005 1366 3UTR 100% 13.200 10.560 N RIOK3 n/a
4 TRCN0000199861 GCAAGTGTCCATGGGCTATTC pLKO.1 212 3UTR 100% 10.800 8.640 N RIOK3 n/a
5 TRCN0000005418 GCTCAGCATTGAGAGAATAAA pLKO.1 1898 3UTR 100% 15.000 10.500 N RIOK3 n/a
6 TRCN0000342664 GCTCAGCATTGAGAGAATAAA pLKO_005 1898 3UTR 100% 15.000 10.500 N RIOK3 n/a
7 TRCN0000194747 CAATGCTGTTTCAGGCTTAAA pLKO.1 1570 3UTR 100% 13.200 9.240 N RIOK3 n/a
8 TRCN0000196653 GTTGCGTCTTTCCTTGAATAT pLKO.1 2140 3UTR 100% 13.200 9.240 N RIOK3 n/a
9 TRCN0000342665 GTTGCGTCTTTCCTTGAATAT pLKO_005 2140 3UTR 100% 13.200 9.240 N RIOK3 n/a
10 TRCN0000195009 CCAAACTTTCTGTCTGGTAAT pLKO.1 3185 3UTR 100% 10.800 7.560 N RIOK3 n/a
11 TRCN0000195187 CCACTAAAGATCCAAACTTTC pLKO.1 3174 3UTR 100% 10.800 7.560 N RIOK3 n/a
12 TRCN0000005422 GCCAAAGAATTGCAGTTAGAA pLKO.1 283 3UTR 100% 5.625 3.938 N RIOK3 n/a
13 TRCN0000005421 CCACCACTACTATATGATGAA pLKO.1 1712 3UTR 100% 4.950 3.465 N RIOK3 n/a
14 TRCN0000005419 GCCTACTATCAAACTCTTCAT pLKO.1 1306 3UTR 100% 4.950 3.465 N RIOK3 n/a
15 TRCN0000196572 GTAAACTAAATCCACGTAAGA pLKO.1 1103 3UTR 100% 4.950 3.465 N RIOK3 n/a
16 TRCN0000005420 CCTGAGTTTCAGGTAGGAGAT pLKO.1 703 3UTR 100% 4.050 2.835 N RIOK3 n/a
17 TRCN0000194900 CTGTTGTCTTTCATGCATATG pLKO.1 941 3UTR 100% 0.000 0.000 N RIOK3 n/a
18 TRCN0000342726 CTGTTGTCTTTCATGCATATG pLKO_005 941 3UTR 100% 0.000 0.000 N RIOK3 n/a
19 TRCN0000023872 GCTCAGATGCTACAGATGGAA pLKO.1 394 3UTR 100% 3.000 1.800 N Riok3 n/a
20 TRCN0000297868 GCTCAGATGCTACAGATGGAA pLKO_005 394 3UTR 100% 3.000 1.800 N Riok3 n/a
21 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 2742 3UTR 100% 4.050 2.025 Y P3H4 n/a
22 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 2742 3UTR 100% 4.050 2.025 Y ORAI2 n/a
23 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 2742 3UTR 100% 4.050 2.025 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_145477.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491376 TTAACGGTAGTAGCGGATTGGAGG pLX_317 13.9% 43.2% V5 (not translated due to prior stop codon) 1_153del;1406_1427del;1733_3596del n/a
2 ccsbBroadEn_14912 pDONR223 100% 42.8% None (many diffs) n/a
3 ccsbBroad304_14912 pLX_304 0% 42.8% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000472931 GTTAGGCGCCTACCGCCTGCTCTA pLX_317 27.2% 42.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV