Transcript: Human NR_147097.2

Homo sapiens methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2 like (MTHFD2L), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
MTHFD2L (441024)
Length:
2487
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_147097.2
NBCI Gene record:
MTHFD2L (441024)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_147097.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265805 CCAAGAGTCAGCGGTATATTA pLKO_005 467 3UTR 100% 15.000 21.000 N Mthfd2l n/a
2 TRCN0000051374 CCCAAGAGTCAGCGGTATATT pLKO.1 466 3UTR 100% 15.000 21.000 N MTHFD2L n/a
3 TRCN0000078408 CCCTCTTCTGTTACAGAATTT pLKO.1 2201 3UTR 100% 13.200 9.240 N MTHFD2L n/a
4 TRCN0000051376 CCTCTGCTGTAGGTATTTGTA pLKO.1 372 3UTR 100% 5.625 3.938 N MTHFD2L n/a
5 TRCN0000078409 CCAAAGTTGATTACGTCTGAT pLKO.1 964 3UTR 100% 4.950 3.465 N MTHFD2L n/a
6 TRCN0000051377 GCGAACAATATGCAATGGAAT pLKO.1 520 3UTR 100% 4.950 3.465 N MTHFD2L n/a
7 TRCN0000078410 GCTGGCTTTATCACTCCAGTT pLKO.1 1099 3UTR 100% 4.050 2.835 N MTHFD2L n/a
8 TRCN0000051375 GCCATACATATGTCAGGAATA pLKO.1 339 3UTR 100% 0.000 0.000 N MTHFD2L n/a
9 TRCN0000256658 TGATGTGGGTATCAACTATAT pLKO_005 1011 3UTR 100% 13.200 18.480 N Mthfd2l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_147097.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13694 pDONR223 100% 16.6% None (many diffs) n/a
2 ccsbBroad304_13694 pLX_304 0% 16.6% V5 (many diffs) n/a
3 TRCN0000472987 ATCTCCGTTAAATGTTGACGAACG pLX_317 86.2% 16.6% V5 (many diffs) n/a
4 ccsbBroadEn_13695 pDONR223 100% 8.4% None 1_984del;1195_2487del n/a
5 ccsbBroad304_13695 pLX_304 0% 8.4% V5 1_984del;1195_2487del n/a
6 TRCN0000467739 AGTTTAGGAATAACAATACATCTC pLX_317 100% 8.4% V5 1_984del;1195_2487del n/a
Download CSV