Transcript: Human NR_147137.2

Homo sapiens RIC8 guanine nucleotide exchange factor B (RIC8B), transcript variant 17, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
RIC8B (55188)
Length:
5191
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_147137.2
NBCI Gene record:
RIC8B (55188)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_147137.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230248 CTGCGACTAGCCAAGCTAAAT pLKO_005 341 3UTR 100% 13.200 18.480 N RIC8B n/a
2 TRCN0000230249 GAATCGGCCATAGACCATAAT pLKO_005 689 3UTR 100% 13.200 18.480 N RIC8B n/a
3 TRCN0000230250 TTCTCATCAGTTCCGTGTAAT pLKO_005 811 3UTR 100% 13.200 18.480 N RIC8B n/a
4 TRCN0000006465 CGACAAGCATAGGGCTACTTT pLKO.1 142 3UTR 100% 5.625 7.875 N RIC8B n/a
5 TRCN0000219033 GATGAACTGCCCAGTAATAAA pLKO_005 1001 3UTR 100% 15.000 10.500 N RIC8B n/a
6 TRCN0000257144 TTAAATCCAGAACGCTTTATA pLKO_005 3749 3UTR 100% 15.000 10.500 N RIC8B n/a
7 TRCN0000006464 CCAGTTATTGTGGAGTCATTA pLKO.1 398 3UTR 100% 13.200 9.240 N RIC8B n/a
8 TRCN0000436180 GCTTAAACCAATGGGACTAAA pLKO_005 1788 3UTR 100% 13.200 9.240 N Ric8b n/a
9 TRCN0000420175 CATTAACTGGTTTACTCATTG pLKO_005 1999 3UTR 100% 10.800 7.560 N Ric8b n/a
10 TRCN0000006463 CCTCAGACTTACAAACTGATT pLKO.1 2438 3UTR 100% 4.950 3.465 N RIC8B n/a
11 TRCN0000006466 GCTCTCTTCAATGTGACGGTA pLKO.1 761 3UTR 100% 2.640 1.848 N RIC8B n/a
12 TRCN0000418668 ACTTGTCAACATGCTTGATAA pLKO_005 1606 3UTR 100% 13.200 7.920 N Ric8b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_147137.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12180 pDONR223 100% 28.2% None (many diffs) n/a
2 ccsbBroad304_12180 pLX_304 0% 28.2% V5 (many diffs) n/a
3 TRCN0000477167 ACGTCCTACCCTAAGCCCTGGAGT pLX_317 19.1% 28.2% V5 (many diffs) n/a
Download CSV