Transcript: Mouse NR_149717.1

Mus musculus zinc finger, CCHC domain containing 17 (Zcchc17), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Mus musculus (mouse)
Gene:
Zcchc17 (619605)
Length:
1891
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_149717.1
NBCI Gene record:
Zcchc17 (619605)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_149717.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255311 GTCGTCCTGTCGAGTGGATAA pLKO_005 140 3UTR 100% 10.800 15.120 N Zcchc17 n/a
2 TRCN0000176457 CGACTTACAGACTTAACACAT pLKO.1 1223 3UTR 100% 4.950 3.960 N Zcchc17 n/a
3 TRCN0000198221 CCATTTCAAGCCTCTGCTTAA pLKO.1 1128 3UTR 100% 10.800 7.560 N Zcchc17 n/a
4 TRCN0000255312 GCCAGGTGGAACCAAGTATTC pLKO_005 348 3UTR 100% 10.800 7.560 N Zcchc17 n/a
5 TRCN0000267567 TGCGCTCAGTGTCTTCATTTC pLKO_005 835 3UTR 100% 10.800 7.560 N Zcchc17 n/a
6 TRCN0000200192 CCACTTTGCCAAGGACTGTTT pLKO.1 321 3UTR 100% 4.950 3.465 N Zcchc17 n/a
7 TRCN0000197614 CCTTCTGAGATAGTAGATGTT pLKO.1 162 3UTR 100% 4.950 2.970 N Zcchc17 n/a
8 TRCN0000177253 GAAGAAGAAGAAGCACAAGAA pLKO.1 591 3UTR 100% 4.950 2.475 Y Zcchc17 n/a
9 TRCN0000062684 AGATAGTAGATGTTGGAGATA pLKO.1 169 3UTR 100% 4.950 3.465 N ZCCHC17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_149717.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03330 pDONR223 100% 24.8% None (many diffs) n/a
2 ccsbBroad304_03330 pLX_304 0% 24.8% V5 (many diffs) n/a
3 TRCN0000480571 ACTCGGCCCGCCGTGAGCTCTGCT pLX_317 62.8% 24.8% V5 (many diffs) n/a
Download CSV