Transcript: Human NR_152150.2

Homo sapiens glyceraldehyde-3-phosphate dehydrogenase (GAPDH), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-06-23
Taxon:
Homo sapiens (human)
Gene:
GAPDH (2597)
Length:
763
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_152150.2
NBCI Gene record:
GAPDH (2597)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_152150.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221343 CCTCAACTACATGGTTTACAT pLKO.1 193 3UTR 100% 5.625 7.875 N GAPDH n/a
2 TRCN0000427850 CCAATATGATTCCACCCATGG pLKO_005 217 3UTR 100% 2.250 3.150 N GAPDH n/a
3 TRCN0000221346 GTGGATATTGTTGCCATCAAT pLKO.1 158 3UTR 100% 5.625 3.938 N GAPDH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_152150.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00615 pDONR223 100% 54.5% None (many diffs) n/a
2 ccsbBroad304_00615 pLX_304 0% 54.5% V5 (many diffs) n/a
3 TRCN0000465685 TTTTCCTTCCTAATCTATAGCCTT pLX_317 31.2% 54.5% V5 (many diffs) n/a
4 ccsbBroadEn_06254 pDONR223 100% 54.4% None (many diffs) n/a
5 ccsbBroad304_06254 pLX_304 0% 54.4% V5 (many diffs) n/a
6 TRCN0000474158 ACCTGGGTGCATCCAGAAGGTTGA pLX_317 21.9% 54.4% V5 (many diffs) n/a
Download CSV