Construct: ORF TRCN0000474158
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002235.1_s317c1
- Derived from:
- ccsbBroadEn_06254
- DNA Barcode:
- ACCTGGGTGCATCCAGAAGGTTGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474158
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2597 | GAPDH | glyceraldehyde-3-phosphate ... | NM_001289745.3 | 99.8% | 100% | 381T>C;885T>C |
| 2 | human | 2597 | GAPDH | glyceraldehyde-3-phosphate ... | NM_001289746.2 | 99.8% | 100% | 381T>C;885T>C |
| 3 | human | 2597 | GAPDH | glyceraldehyde-3-phosphate ... | NM_002046.7 | 99.8% | 100% | 381T>C;885T>C |
| 4 | human | 2597 | GAPDH | glyceraldehyde-3-phosphate ... | NM_001357943.2 | 94.4% | 94.6% | 128_129ins54;327T>C;831T>C |
| 5 | human | 2597 | GAPDH | glyceraldehyde-3-phosphate ... | NM_001256799.3 | 87.2% | 87.4% | 0_1ins126;255T>C;759T>C |
| 6 | human | 2597 | GAPDH | glyceraldehyde-3-phosphate ... | NR_152150.2 | 54.4% | (many diffs) | |
| 7 | mouse | 14433 | Gapdh | glyceraldehyde-3-phosphate ... | NM_008084.3 | 88.9% | 93.4% | (many diffs) |
| 8 | mouse | 100042025 | Gapdh-ps15 | glyceraldehyde-3-phosphate ... | XM_001476707.5 | 88.6% | 93.4% | (many diffs) |
| 9 | mouse | 14433 | Gapdh | glyceraldehyde-3-phosphate ... | NM_001289726.1 | 82.6% | 87.4% | (many diffs) |
| 10 | mouse | 14433 | Gapdh | glyceraldehyde-3-phosphate ... | XM_017321385.1 | 78.4% | 77.8% | (many diffs) |
| 11 | mouse | 433273 | Gm5523 | predicted pseudogene 5523; ... | NR_004447.1 | 68.1% | (many diffs) | |
| 12 | mouse | 378954 | 3000002C10Rik | RIKEN cDNA 3000002C10 gene;... | NR_033215.1 | 67.5% | (many diffs) | |
| 13 | mouse | 100151693 | Gm10364 | predicted pseudogene 10364;... | NR_073535.1 | 61.8% | (many diffs) | |
| 14 | mouse | 629557 | Gm6981 | predicted pseudogene 6981; ... | NR_023357.1 | 60% | (many diffs) | |
| 15 | mouse | 654472 | Gm12070 | predicted gene 12070; glyce... | NR_002890.1 | 51.1% | (many diffs) | |
| 16 | mouse | 277333 | Gm5069 | predicted pseudogene 5069; ... | NR_003623.1 | 24.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1071
- ORF length:
- 1005
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg gaaggtgaag gtcggagtca acggatttgg tcgtattggg cgcctggtca 121 ccagggctgc ttttaactct ggtaaagtgg atattgttgc catcaatgac cccttcattg 181 acctcaacta catggtttac atgttccaat atgattccac ccatggcaaa ttccatggca 241 ccgtcaaggc tgagaacggg aagcttgtca tcaatggaaa tcccatcacc atcttccagg 301 agcgagatcc ctccaaaatc aagtggggcg atgctggcgc tgagtacgtc gtggagtcca 361 ctggcgtctt caccaccatg gagaaggctg gggctcattt gcagggggga gccaaaaggg 421 tcatcatctc tgccccctct gctgacgccc ccatgttcgt catgggtgtg aaccatgaga 481 agtatgacaa cagcctcaag atcatcagca atgcctcctg caccaccaac tgcttagcac 541 ccctggccaa ggtcatccat gacaactttg gtatcgtgga aggactcatg accacagtcc 601 atgccatcac tgccacccag aagactgtgg atggcccctc cgggaaactg tggcgtgatg 661 gccgcggggc tctccagaac atcatccctg cctctactgg cgctgccaag gctgtgggca 721 aggtcatccc tgagctgaac gggaagctca ctggcatggc cttccgtgtc cccactgcca 781 acgtgtcagt ggtggacctg acctgccgtc tagaaaaacc tgccaaatat gatgacatca 841 agaaggtggt gaagcaGGCG TCGGAGGGCC CCCTCAAGGG CATCCTGGGC TACACTGAGC 901 ACCAGGTGGT CTCCTCTGAC TTCAACAGCG ACACCCACTC CTCCACCTTC GACGCTGGGG 961 CTGGCATTGC CCTCAACGAC CACTTTGTCA AGCTCATTTC CTGGTATGAC AACGAATTTG 1021 GCTACAGCAA CAGGGTGGTG GACCTCATGG CCCACATGGC CTCCAAGGAG TACCCAACTT 1081 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1141 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1201 CTTGTGGAAA GGACGAACCT GGGTGCATCC AGAAGGTTGA ACGCGTTAAG TCgacaatca 1261 acctctggat tacaaaattt gtgaaagatt