Transcript: Human NR_156436.1

Homo sapiens bridging integrator 3 (BIN3), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2018-06-03
Taxon:
Homo sapiens (human)
Gene:
BIN3 (55909)
Length:
1744
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_156436.1
NBCI Gene record:
BIN3 (55909)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_156436.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275904 ATTGTGGCCGATGACTGAATC pLKO_005 999 3UTR 100% 10.800 15.120 N BIN3 n/a
2 TRCN0000275905 AGCGGATGGATGCCTTCAATC pLKO_005 366 3UTR 100% 10.800 8.640 N BIN3 n/a
3 TRCN0000285461 CATGCGTTGTGGGCATCAAAT pLKO_005 1357 3UTR 100% 13.200 9.240 N BIN3 n/a
4 TRCN0000275903 CGGAAATGCACAAGATCTTTG pLKO_005 883 3UTR 100% 10.800 7.560 N BIN3 n/a
5 TRCN0000146413 CAGTGGAGAGAGACTTTGAAA pLKO.1 153 3UTR 100% 5.625 3.938 N BIN3 n/a
6 TRCN0000130975 CCAGATCCAGAAGACTGTGAT pLKO.1 400 3UTR 100% 4.950 3.465 N BIN3 n/a
7 TRCN0000146275 CCTTTGCAATGAATGACTCTT pLKO.1 1138 3UTR 100% 4.950 3.465 N BIN3 n/a
8 TRCN0000129928 GAAGATATCCTTGGACTTACT pLKO.1 277 3UTR 100% 4.950 3.465 N BIN3 n/a
9 TRCN0000275961 GAAGATATCCTTGGACTTACT pLKO_005 277 3UTR 100% 4.950 3.465 N BIN3 n/a
10 TRCN0000148000 GTGAAGATATCCTTGGACTTA pLKO.1 275 3UTR 100% 4.950 3.465 N BIN3 n/a
11 TRCN0000148593 CAAGAAACAGATTGTGCCCAA pLKO.1 130 3UTR 100% 2.160 1.512 N BIN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_156436.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08609 pDONR223 100% 43.4% None (many diffs) n/a
2 ccsbBroad304_08609 pLX_304 0% 43.4% V5 (many diffs) n/a
3 TRCN0000468069 CCTTACAGGTTCCCTTATCCAGAA pLX_317 1.7% 43.4% V5 (many diffs) n/a
4 ccsbBroadEn_12289 pDONR223 100% 34.1% None (many diffs) n/a
5 ccsbBroad304_12289 pLX_304 0% 34.1% V5 (many diffs) n/a
6 TRCN0000472704 ACTGATTACGTGAACTTCATCCAC pLX_317 79.4% 34.1% V5 (many diffs) n/a
Download CSV