Transcript: Human NR_158766.1

Homo sapiens discs large MAGUK scaffold protein 1 (DLG1), transcript variant 28, non-coding RNA.

Source:
NCBI, updated 2019-06-12
Taxon:
Homo sapiens (human)
Gene:
DLG1 (1739)
Length:
4630
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_158766.1
NBCI Gene record:
DLG1 (1739)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_158766.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006101 CGGGTCAATGACTGTATATTA pLKO.1 527 3UTR 100% 15.000 21.000 N DLG1 n/a
2 TRCN0000318827 CGGGTCAATGACTGTATATTA pLKO_005 527 3UTR 100% 15.000 21.000 N DLG1 n/a
3 TRCN0000006104 CCTATGAAAGACAGGATAAAT pLKO.1 2016 3UTR 100% 15.000 12.000 N DLG1 n/a
4 TRCN0000006103 GCAGTGAATAACGTATGTTTA pLKO.1 833 3UTR 100% 13.200 9.240 N DLG1 n/a
5 TRCN0000318828 GCAGTGAATAACGTATGTTTA pLKO_005 833 3UTR 100% 13.200 9.240 N DLG1 n/a
6 TRCN0000006102 CCCACAAGTATGTATATGAAT pLKO.1 929 3UTR 100% 5.625 3.938 N DLG1 n/a
7 TRCN0000318830 CCCACAAGTATGTATATGAAT pLKO_005 929 3UTR 100% 5.625 3.938 N DLG1 n/a
8 TRCN0000006105 GCACAGATGCAGATTATGAAT pLKO.1 360 3UTR 100% 5.625 3.938 N DLG1 n/a
9 TRCN0000318762 GCACAGATGCAGATTATGAAT pLKO_005 360 3UTR 100% 5.625 3.938 N DLG1 n/a
10 TRCN0000025405 CCAGTGAATCAACAAGAAGTT pLKO.1 1965 3UTR 100% 4.950 3.465 N Dlg1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_158766.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14615 pDONR223 52.1% 48.7% None (many diffs) n/a
2 ccsbBroad304_14615 pLX_304 0% 48.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000471116 TTCGAAGCCCGGCTAAACTAAATC pLX_317 13.6% 48.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV