Transcript: Human NR_160431.1

Homo sapiens centrosomal protein 83 (CEP83), transcript variant 16, non-coding RNA.

Source:
NCBI, updated 2019-01-08
Taxon:
Homo sapiens (human)
Gene:
CEP83 (51134)
Length:
2363
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_160431.1
NBCI Gene record:
CEP83 (51134)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_160431.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242817 AGGCTGAAGTAGCGGAATTAA pLKO_005 949 3UTR 100% 15.000 10.500 N CEP83 n/a
2 TRCN0000167263 CATACATTTCTCAAGTCAGAA pLKO.1 729 3UTR 100% 4.950 3.465 N CEP83 n/a
3 TRCN0000168620 GTAGCGGAATTAAAGGCTGAA pLKO.1 957 3UTR 100% 4.050 2.835 N CEP83 n/a
4 TRCN0000242818 GTACCTACTACATGCTGTATT pLKO_005 1958 3UTR 100% 0.000 0.000 N CEP83 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_160431.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11953 pDONR223 100% 38.3% None (many diffs) n/a
2 ccsbBroad304_11953 pLX_304 0% 38.3% V5 (many diffs) n/a
3 TRCN0000474221 AGAGGAAGCCAATAGCGCCGGCAT pLX_317 25.4% 38.3% V5 (many diffs) n/a
Download CSV