Transcript: Human NR_161281.1

Homo sapiens cell division cycle 45 (CDC45), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-04-16
Taxon:
Homo sapiens (human)
Gene:
CDC45 (8318)
Length:
1656
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_161281.1
NBCI Gene record:
CDC45 (8318)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_161281.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433655 ATATACGCTGGTTCCAGTTTC pLKO_005 187 3UTR 100% 10.800 15.120 N CDC45 n/a
2 TRCN0000418699 CAACGATACCCAGATCAAATT pLKO_005 379 3UTR 100% 13.200 9.240 N CDC45 n/a
3 TRCN0000145466 GCAGACTTTCAGCATTCATTT pLKO.1 1123 3UTR 100% 13.200 9.240 N CDC45 n/a
4 TRCN0000141066 CCAGTCAATGTCGTCAATGTA pLKO.1 356 3UTR 100% 5.625 3.938 N CDC45 n/a
5 TRCN0000145195 GCAAGAACTTGAAACTGCATT pLKO.1 214 3UTR 100% 4.950 3.465 N CDC45 n/a
6 TRCN0000140824 GCAAGTTTCTGGACGCACTTA pLKO.1 1490 3UTR 100% 4.950 3.465 N CDC45 n/a
7 TRCN0000173191 CCTCTCAGTAATTGAGCTGAA pLKO.1 1455 3UTR 100% 4.050 2.835 N Cdc45 n/a
8 TRCN0000279261 CCTCTCAGTAATTGAGCTGAA pLKO_005 1455 3UTR 100% 4.050 2.835 N Cdc45 n/a
9 TRCN0000145081 GCTAATGTAGACCTATTGGAT pLKO.1 284 3UTR 100% 3.000 2.100 N CDC45 n/a
10 TRCN0000139672 CGGAGAAGAGACATCCTCTTT pLKO.1 587 3UTR 100% 0.495 0.347 N CDC45 n/a
11 TRCN0000144130 CTCATAAACTGTGGAGCTAAT pLKO.1 269 3UTR 100% 10.800 6.480 N CDC45 n/a
12 TRCN0000193254 CAAGAACTTGAAACTGCATAT pLKO.1 215 3UTR 100% 10.800 7.560 N Cdc45 n/a
13 TRCN0000176220 GCAAGAACTTGAAACTGCATA pLKO.1 214 3UTR 100% 4.950 3.465 N Cdc45 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_161281.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07220 pDONR223 100% 78.4% None (many diffs) n/a
2 ccsbBroad304_07220 pLX_304 0% 78.4% V5 (many diffs) n/a
3 TRCN0000477447 ATGAGCCGATCAGATTATCTGCCA pLX_317 17.6% 78.4% V5 (many diffs) n/a
Download CSV