Transcript: Human NR_161424.1

Homo sapiens solute carrier family 38 member 7 (SLC38A7), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-04-11
Taxon:
Homo sapiens (human)
Gene:
SLC38A7 (55238)
Length:
4233
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_161424.1
NBCI Gene record:
SLC38A7 (55238)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_161424.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436382 GAGAGTCGGTAGATCTCATAA pLKO_005 2255 3UTR 100% 13.200 18.480 N SLC38A7 n/a
2 TRCN0000418139 GTACGTCACAGCCATCGTTAT pLKO_005 1029 3UTR 100% 10.800 15.120 N SLC38A7 n/a
3 TRCN0000060156 GACCAGCAGGACAAGATTATA pLKO.1 847 3UTR 100% 15.000 10.500 N SLC38A7 n/a
4 TRCN0000060157 CGGCAAGGTGATCTCAGTCAT pLKO.1 1566 3UTR 100% 4.950 3.465 N SLC38A7 n/a
5 TRCN0000060153 CTGTGCCTCATTCAAGCCAAA pLKO.1 1802 3UTR 100% 4.050 2.835 N SLC38A7 n/a
6 TRCN0000060154 CCCTTGGTACACAGACCGCAA pLKO.1 903 3UTR 100% 0.720 0.504 N SLC38A7 n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2995 3UTR 100% 4.950 2.475 Y ERAP2 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2996 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_161424.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03558 pDONR223 100% 32.7% None 1_393del;1623_1797del;1955_4233del n/a
2 ccsbBroad304_03558 pLX_304 0% 32.7% V5 1_393del;1623_1797del;1955_4233del n/a
3 TRCN0000468239 CTGATCCGCTGCAACAGCATCTCA pLX_317 34.9% 32.7% V5 1_393del;1623_1797del;1955_4233del n/a
Download CSV