Transcript: Mouse NM_022319.2

Mus musculus calsyntenin 2 (Clstn2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Clstn2 (64085)
Length:
4494
CDS:
193..3093

Additional Resources:

NCBI RefSeq record:
NM_022319.2
NBCI Gene record:
Clstn2 (64085)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_022319.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094737 CTATATCAACTCCCGGCAATT pLKO.1 1956 CDS 100% 10.800 15.120 N Clstn2 n/a
2 TRCN0000094734 CGCATTATGTTGCCGGTCAAT pLKO.1 3926 3UTR 100% 4.950 6.930 N Clstn2 n/a
3 TRCN0000094735 CGGAGTCATAACTGAGAACAA pLKO.1 345 CDS 100% 4.950 6.930 N Clstn2 n/a
4 TRCN0000094736 CCAGAAAGTCTCCTATATCAA pLKO.1 1944 CDS 100% 5.625 3.938 N Clstn2 n/a
5 TRCN0000094738 GTCAACCCTATGGAGAAACAT pLKO.1 2857 CDS 100% 5.625 3.938 N Clstn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022319.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12444 pDONR223 100% 87.1% 92.5% None (many diffs) n/a
2 ccsbBroad304_12444 pLX_304 0% 87.1% 92.5% V5 (many diffs) n/a
3 TRCN0000481401 TAGTCACCGCCTACTTCAGGTGGC pLX_317 14.7% 87.1% 92.5% V5 (many diffs) n/a
Download CSV