Transcript: Human NM_001005915.1

Homo sapiens erb-b2 receptor tyrosine kinase 3 (ERBB3), transcript variant s, mRNA.

Source:
NCBI, updated 2019-06-04
Taxon:
Homo sapiens (human)
Gene:
ERBB3 (2065)
Length:
1050
CDS:
194..745

Additional Resources:

NCBI RefSeq record:
NM_001005915.1
NBCI Gene record:
ERBB3 (2065)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001005915.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194972 CTTCGTCATGTTGAACTATAA pLKO.1 544 CDS 100% 13.200 18.480 N ERBB3 n/a
2 TRCN0000230091 TTCGTCATGTTGAACTATAAC pLKO_005 545 CDS 100% 13.200 18.480 N ERBB3 n/a
3 TRCN0000010344 GAATTCTCTACTCTACCATTG pLKO.1 470 CDS 100% 0.000 0.000 N ERBB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005915.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10806 pDONR223 100% 52.3% 44.4% None (many diffs) n/a
2 ccsbBroad304_10806 pLX_304 0% 52.3% 44.4% V5 (many diffs) n/a
3 TRCN0000481555 AGGCGAGCCAACTGCTTGACAGGT pLX_317 53.7% 52.3% 44.4% V5 (many diffs) n/a
4 ccsbBroad304_14632 pLX_304 11.8% 12.9% 10.9% V5 (many diffs) n/a
5 TRCN0000480432 CTGACGCAGTTTGTCTGTGAGAGG pLX_317 8.6% 12.9% 10.9% V5 (many diffs) n/a
6 ccsbBroadEn_14632 pDONR223 0% 12.9% 10.9% None (many diffs) n/a
7 TRCN0000489936 ATCGTACGAATTATGCCTGTGTGC pLX_317 10.8% 12.9% 10.9% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000491817 GCTTTGGTTCCCATGATTGGGTGG pLX_317 8.5% 12.9% 10.9% V5 (many diffs) n/a
Download CSV