Transcript: Human NM_022002.2

Homo sapiens nuclear receptor subfamily 1 group I member 2 (NR1I2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
NR1I2 (8856)
Length:
2772
CDS:
49..1470

Additional Resources:

NCBI RefSeq record:
NM_022002.2
NBCI Gene record:
NR1I2 (8856)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022002.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021620 CGAGCTGTGTCAACTGAGATT pLKO.1 1008 CDS 100% 4.950 3.960 N NR1I2 n/a
2 TRCN0000021623 CACTACCTTCTCCCATTTCAA pLKO.1 654 CDS 100% 5.625 3.938 N NR1I2 n/a
3 TRCN0000021619 GCCTTGATCAAGCGGAAGAAA pLKO.1 532 CDS 100% 5.625 3.938 N NR1I2 n/a
4 TRCN0000021622 CATGCTGAAATTCCACTACAT pLKO.1 1131 CDS 100% 4.950 3.465 N NR1I2 n/a
5 TRCN0000021621 CGGCATGAAGAAGGAGATGAT pLKO.1 480 CDS 100% 4.950 3.465 N NR1I2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022002.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11312 pDONR223 100% 79.9% 79.9% None 1_282del;636_638delGCT n/a
2 ccsbBroad304_11312 pLX_304 0% 79.9% 79.9% V5 1_282del;636_638delGCT n/a
3 TRCN0000466920 CTTACGAAGTAAATTCTCACCAAT pLX_317 36% 79.9% 79.9% V5 1_282del;636_638delGCT n/a
4 TRCN0000488621 GTTCGACACCAGCTCGGATCGACC pLX_317 23.3% 79.8% 79.7% V5 1_282del;636_638delGCT;1419_1420insG n/a
Download CSV