Transcript: Mouse NM_011356.4

Mus musculus frizzled-related protein (Frzb), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Frzb (20378)
Length:
2920
CDS:
557..1528

Additional Resources:

NCBI RefSeq record:
NM_011356.4
NBCI Gene record:
Frzb (20378)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011356.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034488 CAACTATGTCATCCGGGCTAA pLKO.1 1141 CDS 100% 4.050 5.670 N Frzb n/a
2 TRCN0000089543 CGAGCCCATTCTCATCAAGTA pLKO.1 913 CDS 100% 4.950 3.465 N LOC433545 n/a
3 TRCN0000034485 GAGGTAAAGATGAAATGTCAT pLKO.1 1169 CDS 100% 4.950 3.465 N Frzb n/a
4 TRCN0000034487 GCTAGCGATTCCACTCAGAAT pLKO.1 1463 CDS 100% 4.950 3.465 N Frzb n/a
5 TRCN0000034484 CCACTTACTGTCAATGAGGAA pLKO.1 1295 CDS 100% 2.640 1.848 N Frzb n/a
6 TRCN0000034486 GATATGAAACTCCGACACCTT pLKO.1 1424 CDS 100% 2.640 1.848 N Frzb n/a
7 TRCN0000089547 GAACATGACCAAGATGCCCAA pLKO.1 700 CDS 100% 2.160 1.512 N LOC433545 n/a
8 TRCN0000089546 CTTCTTCCTCTGTGCAATGTA pLKO.1 811 CDS 100% 5.625 3.375 N LOC433545 n/a
9 TRCN0000089545 TCCCTGGAACATGACCAAGAT pLKO.1 694 CDS 100% 4.950 2.970 N LOC433545 n/a
10 TRCN0000089544 TGTGCAATGTACGCACCCATT pLKO.1 821 CDS 100% 4.050 2.430 N LOC433545 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011356.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06223 pDONR223 100% 89.1% 91.3% None (many diffs) n/a
2 ccsbBroad304_06223 pLX_304 0% 89.1% 91.3% V5 (many diffs) n/a
3 TRCN0000472645 CTCGCCCATTAAGATGCGGACGTA pLX_317 44.3% 89.1% 91.3% V5 (many diffs) n/a
Download CSV