Transcript: Mouse NM_028279.3

Mus musculus N-acetylated alpha-linked acidic dipeptidase 2 (Naalad2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Naalad2 (72560)
Length:
2690
CDS:
55..2277

Additional Resources:

NCBI RefSeq record:
NM_028279.3
NBCI Gene record:
Naalad2 (72560)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028279.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032226 CGCTACACTAAGAACAAGAAA pLKO.1 1630 CDS 100% 5.625 4.500 N Naalad2 n/a
2 TRCN0000032225 CCTGTATATCATACCATCTAT pLKO.1 1672 CDS 100% 5.625 3.938 N Naalad2 n/a
3 TRCN0000032228 GCTTCTTGAAAGAGCATTCAT pLKO.1 2031 CDS 100% 5.625 3.938 N Naalad2 n/a
4 TRCN0000032224 GCAGTGTCATTTGATCCCTTA pLKO.1 1900 CDS 100% 4.050 2.835 N Naalad2 n/a
5 TRCN0000032227 GCAGAAGTGAAGAAACATATT pLKO.1 2200 CDS 100% 13.200 7.920 N Naalad2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028279.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11444 pDONR223 100% 36.4% 36.2% None (many diffs) n/a
2 ccsbBroad304_11444 pLX_304 0% 36.4% 36.2% V5 (many diffs) n/a
3 TRCN0000469320 TTCCGGTATACTCTACCGGGTAAC pLX_317 48.3% 36.4% 36.2% V5 (many diffs) n/a
Download CSV