Transcript: Mouse NM_172925.2

Mus musculus kelch-like 31 (Klhl31), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Klhl31 (244923)
Length:
6260
CDS:
90..1994

Additional Resources:

NCBI RefSeq record:
NM_172925.2
NBCI Gene record:
Klhl31 (244923)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172925.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191217 CGGGATAACTTCATCGAATTT pLKO.1 675 CDS 100% 13.200 18.480 N Klhl31 n/a
2 TRCN0000192814 GAAGATGCAATACGTTCTGTA pLKO.1 5104 3UTR 100% 4.950 3.960 N Klhl31 n/a
3 TRCN0000130427 GCACAAGACCTGGTCAATTAT pLKO.1 882 CDS 100% 15.000 10.500 N KLHL31 n/a
4 TRCN0000216328 GAACTAACAGACACTTCTTAT pLKO.1 234 CDS 100% 13.200 9.240 N Klhl31 n/a
5 TRCN0000215728 CAAGTCCTTTGATGTCCATAA pLKO.1 332 CDS 100% 10.800 7.560 N Klhl31 n/a
6 TRCN0000200638 CCGAACAATTTATGAAGCTTA pLKO.1 703 CDS 100% 4.950 3.465 N Klhl31 n/a
7 TRCN0000192955 GCAATCACTTATGTTCTGTGT pLKO.1 4940 3UTR 100% 2.640 1.848 N Klhl31 n/a
8 TRCN0000192528 GCTTTGCAACTGCAAACTTTA pLKO.1 5179 3UTR 100% 1.320 0.924 N Klhl31 n/a
9 TRCN0000190357 CGCTTTGCAACTGCAAACTTT pLKO.1 5178 3UTR 100% 0.563 0.394 N Klhl31 n/a
10 TRCN0000192149 GATAGGATATGGTCCATGAAA pLKO.1 5025 3UTR 100% 5.625 3.375 N Klhl31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172925.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10129 pDONR223 100% 87% 91.9% None (many diffs) n/a
2 ccsbBroad304_10129 pLX_304 0% 87% 91.9% V5 (many diffs) n/a
3 TRCN0000477823 ACTTCTCGTCAACATCTCTATTAC pLX_317 23.7% 87% 91.9% V5 (many diffs) n/a
Download CSV