Transcript: Mouse NM_001079903.1

Mus musculus replication initiator 1 (Repin1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Repin1 (58887)
Length:
3106
CDS:
132..1937

Additional Resources:

NCBI RefSeq record:
NM_001079903.1
NBCI Gene record:
Repin1 (58887)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001079903.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175703 GCGAGTCTAATTGTTAGACAT pLKO.1 2922 3UTR 100% 0.495 0.693 N Repin1 n/a
2 TRCN0000173357 GCTCTGTTTAGGAATGGACTT pLKO.1 2075 3UTR 100% 4.050 3.240 N Repin1 n/a
3 TRCN0000194594 CACAGAGTGTGGCAAGAACTT pLKO.1 1448 CDS 100% 4.950 2.970 N Repin1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001079903.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08125 pDONR223 99.6% 73.9% 76.7% None (many diffs) n/a
2 ccsbBroad304_08125 pLX_304 0% 73.9% 76.7% V5 (many diffs) n/a
3 TRCN0000470096 GCTTAGCTGTGCTACTGTAGGAAA pLX_317 24.1% 73.9% 76.7% V5 (many diffs) n/a
4 ccsbBroadEn_08124 pDONR223 100% 73.9% 76.7% None (many diffs) n/a
5 ccsbBroad304_08124 pLX_304 0% 73.9% 76.7% V5 (many diffs) n/a
6 TRCN0000468180 TAGGAGACTCTCTCAGGTGGGAGA pLX_317 24.1% 73.9% 76.7% V5 (many diffs) n/a
Download CSV