Transcript: Mouse NM_053072.3

Mus musculus FYVE, RhoGEF and PH domain containing 6 (Fgd6), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Fgd6 (13998)
Length:
8061
CDS:
295..4494

Additional Resources:

NCBI RefSeq record:
NM_053072.3
NBCI Gene record:
Fgd6 (13998)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053072.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055349 CGCGTCACTTTATCCTTAAAT pLKO.1 1981 CDS 100% 15.000 21.000 N Fgd6 n/a
2 TRCN0000287168 CGCGTCACTTTATCCTTAAAT pLKO_005 1981 CDS 100% 15.000 21.000 N Fgd6 n/a
3 TRCN0000294613 GGCATATCAGAACGAGTTAAA pLKO_005 3642 CDS 100% 13.200 18.480 N Fgd6 n/a
4 TRCN0000294546 CCATACAGTGGTTGGTTATAA pLKO_005 4896 3UTR 100% 15.000 10.500 N Fgd6 n/a
5 TRCN0000055352 CCTGAAGCACTACCTGCTAAA pLKO.1 3225 CDS 100% 10.800 7.560 N Fgd6 n/a
6 TRCN0000287169 CCTGAAGCACTACCTGCTAAA pLKO_005 3225 CDS 100% 10.800 7.560 N Fgd6 n/a
7 TRCN0000055351 GCTTTGGAAAGTCAGCCTTTA pLKO.1 4318 CDS 100% 10.800 7.560 N Fgd6 n/a
8 TRCN0000055348 CGGTCCTTTAGAAATCCACTT pLKO.1 1161 CDS 100% 4.050 2.835 N Fgd6 n/a
9 TRCN0000055350 CCTACTTTGAACCTGGAGGAA pLKO.1 517 CDS 100% 2.640 1.848 N Fgd6 n/a
10 TRCN0000287110 CCTACTTTGAACCTGGAGGAA pLKO_005 517 CDS 100% 2.640 1.848 N Fgd6 n/a
11 TRCN0000160719 CCTGTTCTTCTGTCCTTCAAT pLKO.1 7383 3UTR 100% 5.625 3.938 N RBM4 n/a
12 TRCN0000338541 CCTGTTCTTCTGTCCTTCAAT pLKO_005 7383 3UTR 100% 5.625 3.938 N RBM4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053072.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12273 pDONR223 100% 23.3% 24.9% None (many diffs) n/a
2 ccsbBroad304_12273 pLX_304 0% 23.3% 24.9% V5 (many diffs) n/a
3 TRCN0000478690 AGCGGCTGCCGCATGCCTAAACTA pLX_317 29% 23.3% 24.9% V5 (many diffs) n/a
Download CSV