Transcript: Mouse NM_007791.5

Mus musculus cysteine and glycine-rich protein 1 (Csrp1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Csrp1 (13007)
Length:
1770
CDS:
80..661

Additional Resources:

NCBI RefSeq record:
NM_007791.5
NBCI Gene record:
Csrp1 (13007)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007791.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125080 CAAGTCATGTTACGGCAAGAA pLKO.1 253 CDS 100% 4.950 6.930 N Csrp1 n/a
2 TRCN0000309848 CAAGTCATGTTACGGCAAGAA pLKO_005 253 CDS 100% 4.950 6.930 N Csrp1 n/a
3 TRCN0000125083 GAGGGCAACAGCTTCCATAAA pLKO.1 155 CDS 100% 13.200 9.240 N Csrp1 n/a
4 TRCN0000351668 GAGGGCAACAGCTTCCATAAA pLKO_005 155 CDS 100% 13.200 9.240 N Csrp1 n/a
5 TRCN0000125081 TGCATCCAAGTTTGCCCAGAA pLKO.1 394 CDS 100% 4.050 2.835 N Csrp1 n/a
6 TRCN0000351280 TGCATCCAAGTTTGCCCAGAA pLKO_005 394 CDS 100% 4.050 2.835 N Csrp1 n/a
7 TRCN0000125082 CTGTAAAGGATGCTATGCCAA pLKO.1 577 CDS 100% 2.640 1.848 N Csrp1 n/a
8 TRCN0000334597 CTGTAAAGGATGCTATGCCAA pLKO_005 577 CDS 100% 2.640 1.848 N Csrp1 n/a
9 TRCN0000125079 CCCACATCTTTGGAGACCAAT pLKO.1 993 3UTR 100% 4.950 2.970 N Csrp1 n/a
10 TRCN0000351560 CCCACATCTTTGGAGACCAAT pLKO_005 993 3UTR 100% 4.950 2.970 N Csrp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007791.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06059 pDONR223 100% 90.6% 98.9% None (many diffs) n/a
2 ccsbBroad304_06059 pLX_304 0% 90.6% 98.9% V5 (many diffs) n/a
3 TRCN0000476287 TCAGTTGTACACACGCTATTCCTC pLX_317 40.7% 90.6% 98.9% V5 (many diffs) n/a
Download CSV