Transcript: Human NM_001130037.1

Homo sapiens ELMO domain containing 1 (ELMOD1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
ELMOD1 (55531)
Length:
2967
CDS:
405..1385

Additional Resources:

NCBI RefSeq record:
NM_001130037.1
NBCI Gene record:
ELMOD1 (55531)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001130037.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143965 CTGCTCATATTGTGGCATTAT pLKO.1 1581 3UTR 100% 13.200 18.480 N ELMOD1 n/a
2 TRCN0000122881 GCTTGCCTTCTGCAAATCGTT pLKO.1 714 CDS 100% 3.000 2.400 N ELMOD1 n/a
3 TRCN0000122840 CACTGGAATCTCGGATTTCTA pLKO.1 853 CDS 100% 5.625 3.938 N ELMOD1 n/a
4 TRCN0000144158 CCTAAGTGTATGATGCTTGAA pLKO.1 2416 3UTR 100% 4.950 3.465 N ELMOD1 n/a
5 TRCN0000144157 CTCGGAAGGTTTAATCAACAT pLKO.1 1361 CDS 100% 4.950 3.465 N ELMOD1 n/a
6 TRCN0000140636 GCAGACTTCTGTGAGTGTTCA pLKO.1 602 CDS 100% 4.950 3.465 N ELMOD1 n/a
7 TRCN0000121859 GCTGAATCTCATTCTGTGAAA pLKO.1 1736 3UTR 100% 4.950 3.465 N ELMOD1 n/a
8 TRCN0000139529 CCTTCTGCAAATCGTTGGGTA pLKO.1 719 CDS 100% 2.640 1.848 N ELMOD1 n/a
9 TRCN0000122236 GCAAACATTCTGCTATTTGAT pLKO.1 1202 CDS 100% 5.625 3.375 N ELMOD1 n/a
10 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1888 3UTR 100% 4.950 2.475 Y CFLAR n/a
11 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1888 3UTR 100% 4.950 2.475 Y C19orf31 n/a
12 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1886 3UTR 100% 4.950 2.475 Y ERN2 n/a
13 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1886 3UTR 100% 4.950 2.475 Y P3H4 n/a
14 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1886 3UTR 100% 4.950 2.475 Y P3H4 n/a
15 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 2054 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130037.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12222 pDONR223 100% 82.3% 82.3% None 1_153del;621_622ins24 n/a
2 ccsbBroad304_12222 pLX_304 0% 82.3% 82.3% V5 1_153del;621_622ins24 n/a
3 TRCN0000491804 ATGACGGTAAGCCACACGTCGGGC pLX_317 46.7% 82.3% 82.3% V5 1_153del;621_622ins24 n/a
Download CSV