Transcript: Mouse NM_001004176.2

Mus musculus mastermind like 3 (Drosophila) (Maml3), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Maml3 (433586)
Length:
6514
CDS:
864..4271

Additional Resources:

NCBI RefSeq record:
NM_001004176.2
NBCI Gene record:
Maml3 (433586)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001004176.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243591 GATAGGACCTGCCGGTTTATA pLKO_005 5329 3UTR 100% 15.000 21.000 N Maml3 n/a
2 TRCN0000243590 GCCGCGAATGGTAGTAGTATC pLKO_005 891 CDS 100% 10.800 15.120 N Maml3 n/a
3 TRCN0000243592 TGCGAGCATCGAGGTTGATTG pLKO_005 3322 CDS 100% 10.800 15.120 N Maml3 n/a
4 TRCN0000193361 CGTAAATTGAGAACATGACAT pLKO.1 4363 3UTR 100% 4.950 3.960 N Maml3 n/a
5 TRCN0000243593 TTGGGTACAAACTCCTTAAAC pLKO_005 2580 CDS 100% 13.200 9.240 N Maml3 n/a
6 TRCN0000243594 AGATAGCAGGTGGCAACTTTG pLKO_005 4060 CDS 100% 10.800 7.560 N Maml3 n/a
7 TRCN0000063893 GCCAAATAACTTGGGTACAAA pLKO.1 2570 CDS 100% 5.625 3.938 N MAML3 n/a
8 TRCN0000173522 GAAGACGACCATGAACAACTA pLKO.1 2513 CDS 100% 4.950 3.465 N Maml3 n/a
9 TRCN0000063896 CCCAAGCCTTTAACAACCAAA pLKO.1 2458 CDS 100% 4.950 2.475 Y MAML3 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5766 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004176.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000481450 TCCCCATCCTGAACCATTGGTTAA pLX_317 13.3% 84.9% 87.3% V5 (many diffs) n/a
2 ccsbBroadEn_14200 pDONR223 100% 84.9% 81.3% None (many diffs) n/a
3 ccsbBroad304_14200 pLX_304 0% 84.9% 81.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV