Transcript: Human NR_022006.1

Homo sapiens KIAA0087 lncRNA (KIAA0087), long non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
KIAA0087 (9808)
Length:
4320
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_022006.1
NBCI Gene record:
KIAA0087 (9808)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_022006.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_022006.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10495 pDONR223 100% 9.5% None 1_271del;525A>G;686_4320del n/a
2 ccsbBroad304_10495 pLX_304 0% 9.5% V5 1_271del;525A>G;686_4320del n/a
3 TRCN0000469132 TGCCCCTTCTCCCATTTGAATTAT pLX_317 98.6% 9.5% V5 1_271del;525A>G;686_4320del n/a
4 ccsbBroadEn_12783 pDONR223 100% 4.3% None (many diffs) n/a
5 ccsbBroad304_12783 pLX_304 0% 4.3% V5 (many diffs) n/a
6 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 4.3% V5 (many diffs) n/a
7 ccsbBroadEn_11616 pDONR223 100% 4% None (many diffs) n/a
8 ccsbBroad304_11616 pLX_304 0% 4% V5 (many diffs) n/a
9 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 4% V5 (many diffs) n/a
Download CSV