Transcript: Mouse NM_001145803.1

Mus musculus male germ cell-associated kinase (Mak), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Mak (17152)
Length:
3562
CDS:
334..2274

Additional Resources:

NCBI RefSeq record:
NM_001145803.1
NBCI Gene record:
Mak (17152)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001145803.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009770 GCTGGAGGCAAGGATATAAAT pLKO.1 1822 CDS 100% 15.000 10.500 N Mak n/a
2 TRCN0000432479 GTGAAGTTGATGAGATCTTTA pLKO_005 944 CDS 100% 13.200 9.240 N Mak n/a
3 TRCN0000427912 CAGACTGGGTGGCTAAGTATG pLKO_005 2240 CDS 100% 10.800 7.560 N Mak n/a
4 TRCN0000009768 CCTTTCCTTCAAGAGGAGTAA pLKO.1 1899 CDS 100% 4.950 3.465 N Mak n/a
5 TRCN0000009771 GACGACATTGAGGACGACTTA pLKO.1 1555 CDS 100% 4.950 3.465 N Mak n/a
6 TRCN0000009769 GCGAGAAGTTAAGTCCCTGAA pLKO.1 477 CDS 100% 4.050 2.430 N Mak n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145803.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10956 pDONR223 100% 57.1% 57.8% None (many diffs) n/a
2 ccsbBroad304_10956 pLX_304 0% 57.1% 57.8% V5 (many diffs) n/a
3 TRCN0000469828 TCACTAAAAGCTTCGCAACATTTC pLX_317 30.1% 57.1% 57.8% V5 (many diffs) n/a
4 ccsbBroadEn_14692 pDONR223 0% 57.1% 57.8% None (many diffs) n/a
5 ccsbBroad304_14692 pLX_304 0% 57.1% 57.8% V5 (many diffs) n/a
6 TRCN0000479982 CGCACAATGCGTTGACGATATGGT pLX_317 29.7% 57.1% 57.8% V5 (many diffs) n/a
Download CSV