Transcript: Mouse NM_009922.4

Mus musculus calponin 1 (Cnn1), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Cnn1 (12797)
Length:
1987
CDS:
104..997

Additional Resources:

NCBI RefSeq record:
NM_009922.4
NBCI Gene record:
Cnn1 (12797)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009922.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108828 ACGGGATCATTCTTTGCGAAT pLKO.1 270 CDS 100% 4.050 5.670 N Cnn1 n/a
2 TRCN0000108826 CGTCACCTCTATGATCCCAAA pLKO.1 659 CDS 100% 4.050 5.670 N Cnn1 n/a
3 TRCN0000108827 CGGGATCATTCTTTGCGAATT pLKO.1 271 CDS 100% 0.000 0.000 N Cnn1 n/a
4 TRCN0000108829 CGGCTTGTCTGCTGAAGTAAA pLKO.1 139 CDS 100% 13.200 9.240 N Cnn1 n/a
5 TRCN0000108825 CGTTTGTAACTCGAACACATT pLKO.1 1431 3UTR 100% 4.950 3.465 N Cnn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009922.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00338 pDONR223 100% 89% 97.6% None (many diffs) n/a
2 ccsbBroad304_00338 pLX_304 0% 89% 97.6% V5 (many diffs) n/a
3 TRCN0000473994 TTGCCTACAGGTCACGACGCCCAG pLX_317 58.3% 89% 97.6% V5 (many diffs) n/a
Download CSV