Transcript: Mouse NM_146241.2

Mus musculus TRH-degrading enzyme (Trhde), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Trhde (237553)
Length:
5722
CDS:
71..3148

Additional Resources:

NCBI RefSeq record:
NM_146241.2
NBCI Gene record:
Trhde (237553)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146241.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031101 GCAGAGGCATTACAATCTGAA pLKO.1 754 CDS 100% 4.950 6.930 N Trhde n/a
2 TRCN0000031102 CCAAACTTATCAGTGGAGTTA pLKO.1 2949 CDS 100% 4.950 3.960 N Trhde n/a
3 TRCN0000031100 CGGCTACTTTAGAGTCAACTA pLKO.1 2131 CDS 100% 4.950 3.465 N Trhde n/a
4 TRCN0000031099 GCAGGCTATTTGCCTCAGAAT pLKO.1 2261 CDS 100% 4.950 3.465 N Trhde n/a
5 TRCN0000031103 GCCAGAAATGATCTCTGGAAT pLKO.1 1760 CDS 100% 0.495 0.347 N Trhde n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146241.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03116 pDONR223 100% 90% 95.8% None (many diffs) n/a
2 ccsbBroad304_03116 pLX_304 0% 90% 95.8% V5 (many diffs) n/a
3 TRCN0000477129 GCTTAACCAACCCTCTTTTCAAAC pLX_317 13.2% 90% 95.8% V5 (many diffs) n/a
Download CSV