Transcript: Human NM_001165258.1

Homo sapiens transmembrane protein 14C (TMEM14C), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
TMEM14C (51522)
Length:
1201
CDS:
386..724

Additional Resources:

NCBI RefSeq record:
NM_001165258.1
NBCI Gene record:
TMEM14C (51522)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001165258.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004944 CATTATGGGAATGAGGTTCTA pLKO.1 607 CDS 100% 4.950 6.930 N TMEM14C n/a
2 TRCN0000004942 GAGCTTAATAAGACCCTCATA pLKO.1 921 3UTR 100% 4.950 6.930 N TMEM14C n/a
3 TRCN0000004945 GAGGTTCTACCACTCTGGAAA pLKO.1 619 CDS 100% 4.950 3.465 N TMEM14C n/a
4 TRCN0000004943 CCTAGCTACATCTGGTACCTT pLKO.1 580 CDS 100% 0.000 0.000 N TMEM14C n/a
5 TRCN0000004946 CGCCAAAGTTGGAGTTAGTAT pLKO.1 685 CDS 100% 5.625 3.375 N TMEM14C n/a
6 TRCN0000368944 TTAATTGCAGGTGCCAGTTTG pLKO_005 656 CDS 100% 10.800 5.400 Y TMEM14B n/a
7 TRCN0000368945 TCAGGATCCAAGGAACGTTTG pLKO_005 553 CDS 100% 6.000 3.000 Y TMEM14B n/a
8 TRCN0000004951 GCCTTTGCATTGGTTTGGCTT pLKO.1 409 CDS 100% 2.640 1.320 Y TMEM14B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001165258.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03324 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03324 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470752 GAATACTCTCGTCTGTTGGCCTCG pLX_317 84.5% 100% 100% V5 n/a
4 ccsbBroadEn_04259 pDONR223 100% 88% 73.6% None (many diffs) n/a
5 ccsbBroad304_04259 pLX_304 0% 88% 73.6% V5 (many diffs) n/a
6 TRCN0000465648 CAGCGGCAAACTCAGCTGAACCGA pLX_317 74.3% 88% 73.6% V5 (many diffs) n/a
7 ccsbBroadEn_16015 pDONR223 0% 87.7% 72.8% None (many diffs) n/a
8 ccsbBroad304_16015 pLX_304 0% 87.7% 72.8% V5 (many diffs) n/a
9 TRCN0000465833 AACACTTAGCGCTCAAGGTAGGTC pLX_317 74.3% 86.2% 72.8% V5 (many diffs) n/a
10 ccsbBroadEn_09090 pDONR223 100% 87.7% 73.6% None (many diffs) n/a
11 ccsbBroad304_09090 pLX_304 0% 87.7% 73.6% V5 (many diffs) n/a
12 TRCN0000466087 GGTCCATACGCCGCTCTGTGTCCA pLX_317 74.3% 87.7% 73.6% V5 (many diffs) n/a
13 ccsbBroadEn_09089 pDONR223 100% 87.5% 71.9% None (many diffs) n/a
14 ccsbBroad304_09089 pLX_304 0% 87.5% 71.9% V5 (many diffs) n/a
15 TRCN0000470596 GAACCAGTCCTCTACACTAACCAT pLX_317 78.4% 87.5% 71.9% V5 (many diffs) n/a
Download CSV