Transcript: Human NM_001008800.2

Homo sapiens chaperonin containing TCP1 subunit 3 (CCT3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
CCT3 (7203)
Length:
1993
CDS:
232..1755

Additional Resources:

NCBI RefSeq record:
NM_001008800.2
NBCI Gene record:
CCT3 (7203)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001008800.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156792 GCCAGAACACAAAGCGTGAAT pLKO.1 263 CDS 100% 4.950 3.960 N CCT3 n/a
2 TRCN0000343602 GCCAGAACACAAAGCGTGAAT pLKO_005 263 CDS 100% 4.950 3.960 N CCT3 n/a
3 TRCN0000155458 GCCAAGTCCATGATCGAAATT pLKO.1 346 CDS 100% 13.200 9.240 N CCT3 n/a
4 TRCN0000343663 GCCAAGTCCATGATCGAAATT pLKO_005 346 CDS 100% 13.200 9.240 N CCT3 n/a
5 TRCN0000158114 CCATGACTGGTGTGGAACAAT pLKO.1 1400 CDS 100% 5.625 3.938 N CCT3 n/a
6 TRCN0000156740 GACATCGTTTCAGGCCACAAA pLKO.1 1678 CDS 100% 4.950 3.465 N CCT3 n/a
7 TRCN0000154461 GCTACTGCGAATTGATGACAT pLKO.1 1662 CDS 100% 4.950 3.465 N CCT3 n/a
8 TRCN0000157446 GTGTAAATGGTGAGACGGGTA pLKO.1 1553 CDS 100% 2.160 1.512 N CCT3 n/a
9 TRCN0000154796 GCGTGGAGTCATGATTAACAA pLKO.1 762 CDS 100% 5.625 3.375 N CCT3 n/a
10 TRCN0000352949 GCGTGGAGTCATGATTAACAA pLKO_005 762 CDS 100% 5.625 3.375 N CCT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001008800.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10206 pDONR223 100% 92.8% 92.8% None 1_3delATG;91_92ins114 n/a
2 ccsbBroad304_10206 pLX_304 0% 92.8% 92.8% V5 1_3delATG;91_92ins114 n/a
3 TRCN0000470018 TATAGGTGATCGAGTCATGACCCC pLX_317 24.6% 92.8% 92.8% V5 1_3delATG;91_92ins114 n/a
Download CSV