Transcript: Mouse NM_133788.2

Mus musculus isoprenylcysteine carboxyl methyltransferase (Icmt), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Icmt (57295)
Length:
4952
CDS:
161..1015

Additional Resources:

NCBI RefSeq record:
NM_133788.2
NBCI Gene record:
Icmt (57295)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133788.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097551 GATAGCCATCAGAGCTTGTTT pLKO.1 355 CDS 100% 5.625 4.500 N Icmt n/a
2 TRCN0000287907 GATAGCCATCAGAGCTTGTTT pLKO_005 355 CDS 100% 5.625 4.500 N Icmt n/a
3 TRCN0000097552 CCCTCCTATGTGGGCTGGTTT pLKO.1 791 CDS 100% 1.650 1.320 N Icmt n/a
4 TRCN0000295336 GATGGTGGTCTTCGGAGAATG pLKO_005 655 CDS 100% 10.800 7.560 N Icmt n/a
5 TRCN0000295337 TCCACTATTCTGAGTACTTAG pLKO_005 468 CDS 100% 10.800 7.560 N Icmt n/a
6 TRCN0000097550 CCAGTCCTCTTGGAATCACTT pLKO.1 418 CDS 100% 4.950 3.465 N Icmt n/a
7 TRCN0000097549 CCCAGGAATAAGTATGGTGAT pLKO.1 3767 3UTR 100% 4.050 2.835 N Icmt n/a
8 TRCN0000287984 CCCAGGAATAAGTATGGTGAT pLKO_005 3767 3UTR 100% 4.050 2.835 N Icmt n/a
9 TRCN0000097553 GAGAACATCTTCTGGCCAGAA pLKO.1 596 CDS 100% 4.050 2.835 N Icmt n/a
10 TRCN0000287908 GAGAACATCTTCTGGCCAGAA pLKO_005 596 CDS 100% 4.050 2.835 N Icmt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133788.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15012 pDONR223 97.1% 89% 96.1% None (many diffs) n/a
2 ccsbBroad304_15012 pLX_304 0% 89% 96.1% V5 (many diffs) n/a
3 TRCN0000471390 TTCTCCATATGTATTAAAACCCTC pLX_317 55.8% 89% 96.1% V5 (many diffs) n/a
4 ccsbBroadEn_02772 pDONR223 100% 89% 96.1% None (many diffs) n/a
5 ccsbBroad304_02772 pLX_304 0% 89% 96.1% V5 (many diffs) n/a
6 TRCN0000475593 TGCTAAATATTCTGCCCGACCCTC pLX_317 32.5% 89% 96.1% V5 (many diffs) n/a
Download CSV