Transcript: Mouse NM_001243163.1

Mus musculus SRY (sex determining region Y)-box 5 (Sox5), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Sox5 (20678)
Length:
7079
CDS:
201..2240

Additional Resources:

NCBI RefSeq record:
NM_001243163.1
NBCI Gene record:
Sox5 (20678)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001243163.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075493 CGAAATAAGCTATGGGTTAAA pLKO.1 2478 3UTR 100% 13.200 18.480 N Sox5 n/a
2 TRCN0000075496 GCCATTGATGATTCCCGTGTT pLKO.1 923 CDS 100% 4.050 5.670 N Sox5 n/a
3 TRCN0000436369 AGCTCATGGGTATGATCAATC pLKO_005 697 CDS 100% 10.800 7.560 N Sox5 n/a
4 TRCN0000075497 GCTATGACCAACCTAGAGAAA pLKO.1 1734 CDS 100% 4.950 3.465 N Sox5 n/a
5 TRCN0000075494 CGGAGAGATTTACGAGGAGTA pLKO.1 2144 CDS 100% 4.050 2.835 N Sox5 n/a
6 TRCN0000075495 GCAGTTAAACAGAATGAAGAA pLKO.1 1473 CDS 100% 4.950 2.970 N Sox5 n/a
7 TRCN0000018297 CCACTGAACCTATCAGCTAAA pLKO.1 1128 CDS 100% 10.800 15.120 N SOX5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243163.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11149 pDONR223 100% 75.2% 77.7% None (many diffs) n/a
2 ccsbBroad304_11149 pLX_304 0% 75.2% 77.7% V5 (many diffs) n/a
3 TRCN0000471554 TAGAGCTACCAGGTATCCCGCGCG pLX_317 21.5% 75.2% 77.7% V5 (many diffs) n/a
Download CSV